ID: 997727355

View in Genome Browser
Species Human (GRCh38)
Location 5:136132915-136132937
Sequence GAGAAGCGCAGCGACGGCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997727351_997727355 10 Left 997727351 5:136132882-136132904 CCGCGGCCGAGCTGCTAATAAAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 997727355 5:136132915-136132937 GAGAAGCGCAGCGACGGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 61
997727352_997727355 4 Left 997727352 5:136132888-136132910 CCGAGCTGCTAATAAAGTTGCAG 0: 1
1: 0
2: 0
3: 10
4: 185
Right 997727355 5:136132915-136132937 GAGAAGCGCAGCGACGGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 61
997727350_997727355 11 Left 997727350 5:136132881-136132903 CCCGCGGCCGAGCTGCTAATAAA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 997727355 5:136132915-136132937 GAGAAGCGCAGCGACGGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 61
997727349_997727355 23 Left 997727349 5:136132869-136132891 CCGTGCGCGTGTCCCGCGGCCGA 0: 1
1: 0
2: 0
3: 1
4: 28
Right 997727355 5:136132915-136132937 GAGAAGCGCAGCGACGGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997727355 Original CRISPR GAGAAGCGCAGCGACGGCGT CGG Exonic
901022176 1:6261040-6261062 GCGAAGCGCGGCGGCGGCGGCGG - Intergenic
906154527 1:43606265-43606287 GAGAGGAGCAGCGGCGGCGGCGG + Exonic
906240181 1:44238033-44238055 GAGAAGAGCAGAGGCCGCGTAGG - Intronic
911073180 1:93847890-93847912 GAGAAGAGCGGCGGCGGCGGCGG + Intergenic
912570548 1:110618044-110618066 GAGAAGAGCAGAGAGGGCCTGGG + Intronic
913959458 1:143327596-143327618 GAGGCGCGCAGCGGCGGCGCAGG + Intergenic
914053818 1:144153169-144153191 GAGGCGCGCAGCGGCGGCGCAGG + Intergenic
914125328 1:144813196-144813218 GAGGCGCGCAGCGGCGGCGCAGG - Intergenic
919712093 1:200738931-200738953 GAAAACCGCAGCGGCGGCGGCGG + Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922717980 1:227886882-227886904 GAGAGGCTCAGCGCCGGGGTGGG - Intergenic
1073048714 10:100654767-100654789 GAGTCGCGCGGCGACGGCGGCGG - Intergenic
1073139699 10:101238977-101238999 GAGAAGGGCACCCAGGGCGTTGG - Intergenic
1075137410 10:119796425-119796447 GAGAAGGACAGCGACGGCAAGGG + Intronic
1077093091 11:788361-788383 GAGAAGGGCAGGGTCGGCCTTGG + Exonic
1088604282 11:111513093-111513115 GAGAAGCGCGGCGTCGGCGTGGG + Intergenic
1096518948 12:52173451-52173473 GAGAAGCACAGGGACGGGGCGGG - Intronic
1100963077 12:99984756-99984778 GAGGAGCGCGGCGGCGGCGGCGG + Intergenic
1100985637 12:100199767-100199789 GAGGAGGGCAGCGACGGCGATGG - Intronic
1101720349 12:107345531-107345553 GAGAAGCCCAGGGACAGGGTTGG + Intronic
1102475426 12:113185491-113185513 GAGGAGCGCACCAACTGCGTGGG + Intergenic
1103518253 12:121521209-121521231 GAGAAGAGCAGCCAGGGCCTGGG + Intronic
1119383071 14:74240777-74240799 GAGGAGCGGAGCGGAGGCGTGGG - Intronic
1122137915 14:99645301-99645323 CAGAGGCGCAGCGGCTGCGTCGG - Exonic
1122890430 14:104729696-104729718 GAGGAGCGTGGCGTCGGCGTCGG + Intronic
1123932565 15:25178929-25178951 GAGGAGCGCAGAGATGGGGTCGG - Intergenic
1123933379 15:25182576-25182598 GAGGAGCGCAGAGACAGGGTTGG - Intergenic
1123936155 15:25195111-25195133 GAGGAGCGCAGAGACAGGGTTGG - Intergenic
1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG + Intronic
1158137717 18:54224570-54224592 AAGAAGCGCAGCGCCGGCTGGGG - Exonic
1162798506 19:13098685-13098707 CAGAAGCGCAGTGACGGGGGCGG - Intronic
1166807676 19:45496913-45496935 GAGAATGGCAGCGGCGTCGTGGG - Exonic
1202693294 1_KI270712v1_random:105827-105849 GAGGCGCGCAGCGGCGGCGCAGG + Intergenic
925081035 2:1066894-1066916 GAGGAGCGTAGCGACGCCATTGG - Intronic
930136229 2:47906060-47906082 GCGAAGCGCGGCGGCGGCGGCGG + Intergenic
930651829 2:53971080-53971102 GCGGGGCGGAGCGACGGCGTCGG + Intronic
932194271 2:69769618-69769640 GGGAAGAGCAGAGAAGGCGTGGG + Intronic
933953274 2:87348732-87348754 GAGGCGCGCAGCGGCGGCGCAGG - Intergenic
934237505 2:90245077-90245099 GAGGCGCGCAGCGGCGGCGCAGG - Intergenic
935590469 2:104842944-104842966 GAGAAGGGGAGCGAAGGGGTGGG + Intergenic
937060594 2:118977848-118977870 GAGAAGGGCAGCAAAGGCGATGG + Exonic
947602698 2:231464400-231464422 AAGAAGCCAAGCGACGGCGATGG + Exonic
948738412 2:240025769-240025791 GAGGAGCGGAGGGACGGGGTGGG + Intergenic
1171373847 20:24678509-24678531 GAGACGGGCAGCGACGGAATGGG + Intergenic
1172904063 20:38355775-38355797 GGAAAGCTCAGCGAGGGCGTGGG + Intronic
1176031860 20:63016731-63016753 AGGAAGCGCAGCCACAGCGTGGG - Intergenic
1178142511 21:29700167-29700189 GTGAAGTGCAGCGAGGACGTAGG + Intronic
1178813466 21:35905605-35905627 GAGCAGGGCAGAGACGGCCTGGG + Intronic
1182281249 22:29218850-29218872 GTGAAGCTCAGAGAGGGCGTGGG + Intronic
1183234373 22:36606261-36606283 CACAAGGGCAGCGAGGGCGTTGG + Intronic
968699308 4:2047172-2047194 TAGGAGCGCCCCGACGGCGTTGG + Intergenic
995650364 5:114362185-114362207 GAGGAGCGCGGCGGCGGCGGCGG - Exonic
997727355 5:136132915-136132937 GAGAAGCGCAGCGACGGCGTCGG + Exonic
1006626268 6:35400241-35400263 GAGAAGGGCAGCCACTGAGTGGG - Intronic
1010141919 6:72622246-72622268 GAGCGGCGCAGCGGCGGCGGCGG + Exonic
1019469522 7:1211337-1211359 GAGCAAAGCAGCGACGGTGTGGG - Intergenic
1024094746 7:45974676-45974698 GAGAAGAGCACCGAGGGCGTGGG - Intergenic
1024920278 7:54546717-54546739 GGAAAGCGCGGGGACGGCGTGGG + Intronic
1036789481 8:11708616-11708638 GAGAAGCGCGGCGACACCGGCGG - Exonic
1038266260 8:26041771-26041793 GAGAAGGGGAGCGGCGGCCTTGG + Intronic
1041359830 8:57041418-57041440 GAGAAGCCCAGCAAAGGCCTTGG + Intergenic
1048248475 8:132835785-132835807 GAGAAACGCAGCCATGGAGTGGG - Intronic
1049405306 8:142449669-142449691 GAGGAGCGGAGCGGCGGCGGCGG + Exonic
1051287429 9:15510949-15510971 GAGCAGCGCAGCTACGGCGGCGG - Exonic
1053214357 9:36258343-36258365 GAGGAGCGCGGTGGCGGCGTGGG - Intronic
1061035174 9:128109496-128109518 GAGAAGCCCAGCGACGTCCTCGG - Intergenic
1061570843 9:131476646-131476668 GAGACGCGCACAGACGGCCTGGG - Intronic
1185714438 X:2330056-2330078 GAGAAGCAGAGAGACGGCGGGGG + Intronic