ID: 997727462

View in Genome Browser
Species Human (GRCh38)
Location 5:136133264-136133286
Sequence GGGTCAGGGGGTCCCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997727462_997727476 18 Left 997727462 5:136133264-136133286 CCCTGGAGGGGACCCCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 997727476 5:136133305-136133327 GGTTTGCTTTCCTAACTCATCGG 0: 1
1: 0
2: 1
3: 12
4: 133
997727462_997727472 -3 Left 997727462 5:136133264-136133286 CCCTGGAGGGGACCCCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 997727472 5:136133284-136133306 CCCCGCGCTGTCCTGGGGAGCGG 0: 1
1: 0
2: 1
3: 33
4: 298
997727462_997727466 -10 Left 997727462 5:136133264-136133286 CCCTGGAGGGGACCCCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 997727466 5:136133277-136133299 CCCCTGACCCCGCGCTGTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 192
997727462_997727470 -8 Left 997727462 5:136133264-136133286 CCCTGGAGGGGACCCCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 997727470 5:136133279-136133301 CCTGACCCCGCGCTGTCCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 149
997727462_997727468 -9 Left 997727462 5:136133264-136133286 CCCTGGAGGGGACCCCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 997727468 5:136133278-136133300 CCCTGACCCCGCGCTGTCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997727462 Original CRISPR GGGTCAGGGGGTCCCCTCCA GGG (reversed) Intronic
900265433 1:1754745-1754767 GGGTCAGGGGCCCCACCCCAGGG + Intronic
900322654 1:2092812-2092834 GGGCCAGGTGGACCCCTGCAGGG + Intronic
900504857 1:3024882-3024904 GGGTCAGTGGGCTCCCTGCAGGG - Intergenic
900868818 1:5287515-5287537 GGGTCTGGGGGGCCTCTCCATGG - Intergenic
901487857 1:9577718-9577740 GAGGTAGGGGGTGCCCTCCAGGG + Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
901703691 1:11058949-11058971 GGGTCAGGGGGTCTGCTTCAGGG - Intronic
902172606 1:14625089-14625111 GTGTCGGGGGGGACCCTCCAGGG - Intronic
904063164 1:27726496-27726518 GGGGCAGGAGGTCCCCACCAGGG - Intronic
905813246 1:40928580-40928602 TGGTCAGGATGGCCCCTCCAAGG - Intergenic
905855663 1:41310464-41310486 GGTACAGTGGGTTCCCTCCAAGG + Intergenic
906668522 1:47638515-47638537 TTGTCAGGGGGTCACCTGCAGGG + Intergenic
910200281 1:84691230-84691252 GGGTCAGGCTGTCTCCTCCCTGG + Intergenic
911254767 1:95621092-95621114 GGGACATGGGGTCCCCTTCTTGG - Intergenic
912545751 1:110450240-110450262 GGGTCAGGGGCTTCCCTCACAGG + Intergenic
912648207 1:111415015-111415037 GGGTCAGGGCCTTCTCTCCAGGG + Exonic
915548350 1:156616657-156616679 GGATCAGGGTGTCCTGTCCAAGG + Intergenic
915661080 1:157405532-157405554 CTCTCAGGGGGTCCCCTCCTGGG - Intergenic
917937554 1:179883125-179883147 GGGTCAGGGTGGCCCTTGCACGG - Intronic
920570799 1:207015864-207015886 AGATCTGGGGGTCCCCTGCATGG - Intronic
1064032100 10:11889272-11889294 TTGTCATGGGGTCCTCTCCACGG - Intergenic
1066508758 10:36072003-36072025 AGCTCAGGGAGTCACCTCCATGG + Intergenic
1069797536 10:71062908-71062930 GAGTCCGGGGAGCCCCTCCATGG + Intergenic
1069920961 10:71815356-71815378 CGGTCGGGGGGGACCCTCCAAGG + Exonic
1070781932 10:79142705-79142727 GGGTCAGGGAGTGCCGGCCAGGG - Intronic
1071470920 10:85983641-85983663 GGGCCAGGGTGTCACATCCAGGG + Intronic
1073139221 10:101236643-101236665 GGGTCAGGGGGCCGCCTGCTGGG + Intergenic
1073325547 10:102642601-102642623 GGGTCCCGGGGCCCCCGCCACGG - Intergenic
1075263483 10:120981847-120981869 GGGGCAGGAGGCCCCCTGCAAGG - Intergenic
1075620506 10:123924342-123924364 GGGTCATGGGAACCCCTACACGG - Intronic
1076372935 10:129966806-129966828 GGACCAGGGGGTACCCTCCCAGG - Intergenic
1076699890 10:132265897-132265919 GGGTTAGGGGGTGCCGTGCACGG + Intronic
1076831438 10:132996365-132996387 GGGGCAGGAGGTCCCCACCTAGG - Intergenic
1077011436 11:380969-380991 GGGTCAGGGTGTCACCTCTGGGG - Intronic
1077090184 11:774900-774922 GGGACAGGGGGACGCCACCAGGG + Intronic
1077914748 11:6603895-6603917 GGGACCGGGGGTCCTCCCCAGGG - Exonic
1078153523 11:8778747-8778769 TGTTCAGGGTGTGCCCTCCAGGG - Intronic
1080214624 11:29827011-29827033 GGATCAGGAGGTCCCCTCATGGG + Intergenic
1081754078 11:45532290-45532312 GGGTGAGGGAGTTCCCTTCAGGG - Intergenic
1084173030 11:67409693-67409715 GGGCCTGGGGGGCCCCTCGATGG - Exonic
1084370828 11:68741628-68741650 GGGTGAGTGGGTGCCCTACATGG + Intronic
1085413852 11:76307403-76307425 GGGTCAGGCCGGCCCCCCCATGG + Intergenic
1085423999 11:76386893-76386915 GCTCCAGTGGGTCCCCTCCAAGG + Intronic
1089111971 11:116064345-116064367 TGGCCATGGGCTCCCCTCCAAGG - Intergenic
1090387615 11:126365861-126365883 GGGCCAGGAAGTGCCCTCCATGG + Intronic
1090390180 11:126383059-126383081 AGGCCAGGGAGTGCCCTCCATGG + Intronic
1096499018 12:52054388-52054410 GGGTCAGGGGGTCGCTTGCCAGG - Exonic
1101692944 12:107097983-107098005 GGCTCAGGGGATCCTCCCCAGGG - Intergenic
1101724148 12:107375532-107375554 GGGCCAGTGGGGCACCTCCAGGG + Intronic
1102171201 12:110843836-110843858 TGGTCAGGTGGTCCCCAACAGGG - Intergenic
1102927297 12:116836034-116836056 GCTTCAGGTGGTCCCCACCAGGG + Intronic
1103330948 12:120153723-120153745 AGGTAAGGGGGTCCCAGCCAGGG - Exonic
1105415428 13:20207663-20207685 GGGTCAGGCAGTCCCCGCCCTGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1113071251 13:106423603-106423625 GGGTCAGGAAGTCCCCCCCAGGG - Intergenic
1113428344 13:110228487-110228509 GGGTCACGTGTTCCCTTCCAAGG - Intronic
1113665963 13:112142351-112142373 GGGCTTGGGGGTCCCCTGCATGG - Intergenic
1113838482 13:113345476-113345498 GGGTCTGGGGCTGCCCTCGATGG - Intronic
1115210907 14:30966760-30966782 GAGTGAGTGGGTCCTCTCCAAGG + Intronic
1117545885 14:56794674-56794696 GGGCCGCCGGGTCCCCTCCAGGG - Intergenic
1117581531 14:57156328-57156350 GGGTCAGGGAGTCTCCACCAAGG + Intergenic
1118320592 14:64750045-64750067 GGGCCAGGGGTTCCTCCCCATGG + Exonic
1118645002 14:67829921-67829943 GGGTCAGGAGGACCCTTGCAAGG + Intronic
1123933151 15:25181566-25181588 GAGCCATGGGGTCACCTCCAGGG + Intergenic
1123936533 15:25196757-25196779 GAGTCATGGGGTCACCTCCAGGG + Intergenic
1123936953 15:25198661-25198683 GAGCCATGGGGTCACCTCCAGGG + Intergenic
1123937389 15:25200566-25200588 GAGTCATGGGGTCACCTCCAGGG + Intergenic
1123947231 15:25244687-25244709 GAGCCACGGGGTCACCTCCAGGG + Intergenic
1123948052 15:25248420-25248442 GAGCCACGGGGTCACCTCCAGGG + Intergenic
1123948471 15:25250268-25250290 GAGCCATGGGGTCACCTCCAGGG + Intergenic
1124157188 15:27236357-27236379 GGGTCAGGGGGTCCATTCAGTGG - Intronic
1126855864 15:52838796-52838818 TGGTCAGGGGGCCTCTTCCATGG + Intergenic
1127098195 15:55534969-55534991 TGGTCAGGGGGTCTCCTGCCAGG - Intergenic
1128145035 15:65328340-65328362 GGGAGAGGGGGTCCCCAGCAAGG + Exonic
1129718701 15:77866231-77866253 GGGTGGGGGGCTCCCTTCCAGGG - Intergenic
1132100115 15:99016779-99016801 GAGTCAGAGGGTTCCTTCCAAGG + Intergenic
1132479960 16:162499-162521 GGCTCAGAGTGTCCCCTACAAGG + Intronic
1132814516 16:1819347-1819369 GGGGCAGGTGCTCCCCACCACGG + Intronic
1132980539 16:2736777-2736799 GGGTCAGTGGGACCCCGCCTTGG - Intergenic
1133324283 16:4934082-4934104 GTGGCAGCGGGTCTCCTCCAGGG + Intronic
1134520884 16:14918752-14918774 GGGTCCGTGGGGCCCCACCAGGG - Intronic
1134550689 16:15137221-15137243 GGGTCCGTGGGGCCCCACCAGGG + Intronic
1134708559 16:16317403-16317425 GGGTCCGTGGGGCCCCACCAGGG - Intergenic
1134715772 16:16357436-16357458 GGGTCCGTGGGGCCCCACCAGGG - Intergenic
1134951045 16:18351242-18351264 GGGTCCGTGGGGCCCCACCAGGG + Intergenic
1134958985 16:18394723-18394745 GGGTCCGTGGGGCCCCACCAGGG + Intergenic
1137979170 16:53055208-53055230 GGGTCTCTGGGTCCCCCCCACGG - Intronic
1138457387 16:57129209-57129231 GGGCCACGGGGACCCCTGCAGGG + Intronic
1138527973 16:57619910-57619932 GGGTCAGGTTGGCCCCTGCAAGG + Intronic
1139374966 16:66491192-66491214 TGGGCAGGAGGGCCCCTCCATGG + Intronic
1139423219 16:66862094-66862116 TGGGGAGGGGTTCCCCTCCAGGG - Intronic
1140069955 16:71640619-71640641 GGGTCTGGGGGTCCTCACCATGG + Exonic
1141149287 16:81552961-81552983 GGGTTTGGGAGTCCCCTCCCTGG + Intronic
1141481198 16:84308119-84308141 GGGCCAGGGGCCCCCCTCCCAGG + Intronic
1141697734 16:85628078-85628100 GGCCCAGGGGGACCCCTCCAAGG + Intronic
1141725268 16:85783836-85783858 AGGGCAGGGGGTCTCATCCAGGG - Intronic
1142133197 16:88440229-88440251 GGGTCAGGGAGGCCCCACCATGG + Exonic
1142620895 17:1165251-1165273 GGGTCACAGGCTCCCCTCCAGGG - Intronic
1142890474 17:2939776-2939798 GGGCAAGGGGGTCCCTTCCAAGG - Intronic
1143166516 17:4899761-4899783 GGAGCTGGGGGTCCCCTTCATGG - Exonic
1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG + Intronic
1145018214 17:19412433-19412455 GGGGCAGGGGGTACCGGCCAGGG - Intronic
1145881151 17:28353653-28353675 GGGCTTGGGGGTCCTCTCCATGG - Intronic
1146111599 17:30094855-30094877 GAGTCAGAGGGTCCCCCACAGGG - Intronic
1147427057 17:40350943-40350965 GGGAGAAGGGGTCCCCTCCCTGG - Intronic
1148892345 17:50817330-50817352 GAGACAGGAGGTCCCCTCCTCGG + Intergenic
1149017439 17:51924708-51924730 AGGTCAGGTGTTCCTCTCCATGG + Intronic
1149668012 17:58379633-58379655 GGGTCAGGAGAACCCCACCATGG - Intronic
1151560800 17:74868593-74868615 GGGTCACGATGTCCTCTCCAGGG + Intronic
1151668589 17:75559177-75559199 GAGTCAGGGGACCCCGTCCATGG + Intronic
1152013763 17:77736217-77736239 GAGACAGTGGGTCCCCTACAGGG - Intergenic
1152699625 17:81812497-81812519 GGGTCAGGTGGGGCCTTCCAAGG + Intronic
1152894183 17:82901276-82901298 AGGTCAGAGGGTCCCCTCCTAGG + Intronic
1153553251 18:6284559-6284581 CGGCCAGTGCGTCCCCTCCAAGG - Intronic
1160691866 19:463994-464016 AGGGCCGGGGGTCTCCTCCAGGG + Exonic
1160754774 19:751501-751523 AGGCCAGAGGGGCCCCTCCATGG + Intronic
1160807440 19:998663-998685 AGGACAAGGGGTCCCCTCCCTGG - Intergenic
1162127652 19:8507973-8507995 GGGTCTGGGGGCCCCGCCCAGGG + Intergenic
1163928139 19:20364591-20364613 TGGTCAGGAGCCCCCCTCCATGG + Intergenic
1165481571 19:36067613-36067635 GGGTCAGGGGGTTCCTGGCAGGG - Intronic
1166091129 19:40509860-40509882 GGGTCAGGATGTCCACACCAGGG - Intronic
1167687496 19:50965758-50965780 GGGTCAGGGGAACCACCCCAGGG + Intronic
1168145368 19:54417017-54417039 GGGCAAGGGGGACCCCTGCAGGG + Intronic
1168354208 19:55691874-55691896 GGGACAGGGGGGCCGCCCCAGGG - Exonic
1168413934 19:56157093-56157115 GGGTCATGGGAGCCCCGCCAAGG + Intronic
924985355 2:264740-264762 GGGTCCGCGGGTCACCTGCAGGG - Intronic
928190154 2:29157699-29157721 AGGTCAGAGGGTCCTCTCCCAGG + Intronic
933779261 2:85790240-85790262 GGATGAGGGGGCCCTCTCCAGGG + Intergenic
937225789 2:120368027-120368049 GGGCCAGGGGCTCCTCCCCATGG + Intergenic
937305308 2:120867218-120867240 GGGGCAGCGGCTGCCCTCCAGGG - Intronic
938143115 2:128812498-128812520 GGGTCACGGGGTACCCTGCTGGG - Intergenic
940909414 2:159196800-159196822 GGGGCAGGGGTTTCCCTCCTGGG + Intronic
942387533 2:175458260-175458282 GGGTCAGACGCTCACCTCCATGG + Intergenic
946318805 2:218936196-218936218 GGGTGAGGAGGTCATCTCCATGG + Intergenic
947714033 2:232330955-232330977 GGCTCAGGGTGCCCCCTCCTAGG - Intronic
947733241 2:232442335-232442357 GGCTCAGGGTGCCCCCTCCTAGG - Intergenic
948336002 2:237207500-237207522 GGTTCAGGAGCCCCCCTCCATGG - Intergenic
948912266 2:241010598-241010620 GGGTCAGAGCATCCCCTCCATGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172116169 20:32574784-32574806 AAGTCACGGGGTCCCCTCCACGG + Intronic
1172188105 20:33044100-33044122 CAATCAGGGGGTCTCCTCCATGG - Intergenic
1172194892 20:33085011-33085033 GGGTGGTGGGGACCCCTCCAGGG - Intronic
1172672378 20:36643420-36643442 GGTGCATGGGTTCCCCTCCAGGG - Intronic
1173021184 20:39269227-39269249 GGGTCTTGGGGCCCCCTCCAGGG + Intergenic
1173452233 20:43175218-43175240 GGCTAAGAAGGTCCCCTCCACGG + Intronic
1174188445 20:48723238-48723260 GGGCCACGGGGACCCCTGCAAGG + Intronic
1175636369 20:60587529-60587551 GAGTCATGGGGTCATCTCCAGGG - Intergenic
1175992303 20:62795702-62795724 GGGGCAGGGGGTCCCCACGCGGG + Intergenic
1176138365 20:63534816-63534838 GGGACATGGGCTCCTCTCCAGGG - Intronic
1178593548 21:33932447-33932469 GGGTCAAGGGGCCATCTCCAAGG - Intergenic
1178918361 21:36722280-36722302 GGGGCAGGGGGTGCCCTCTGAGG + Intronic
1179173448 21:38990734-38990756 GGGCCTGAGGGTCCCTTCCAGGG - Intergenic
1179588393 21:42388748-42388770 GGGTCAGGGAGGGCCTTCCATGG - Intronic
1179793321 21:43768131-43768153 CAGCCAGGGGGCCCCCTCCATGG - Intergenic
1180041587 21:45283122-45283144 GGTTCTGGGCGTCCCCTCCTGGG - Intronic
1180084631 21:45502266-45502288 GGGTGAGGTGGTCCCCACCCCGG + Intronic
1180991684 22:19941054-19941076 GGGTCGAGGGGCCCCCTGCATGG + Intronic
1181051057 22:20238523-20238545 GGGGCAGGCGCTCCCATCCAAGG + Intergenic
1181514087 22:23401704-23401726 GGCTCAGGGGGGGCCCTTCACGG + Intergenic
1181542254 22:23579860-23579882 GTGTCTGTGGCTCCCCTCCAGGG + Intronic
1183276209 22:36899854-36899876 GGGACAGGAGCTCTCCTCCAGGG + Intergenic
1184265710 22:43344765-43344787 GAGGCAAGGGGTCCCCTACATGG + Intergenic
1184772181 22:46603875-46603897 GGGTTATGGGTGCCCCTCCAGGG + Intronic
952252209 3:31665825-31665847 GGGTCAGGGGGTCCTCTGAAGGG + Intronic
954447613 3:50555136-50555158 AGGCCAGGGGGCCCCCTCCCTGG - Intergenic
958483577 3:94676049-94676071 GGGTTAGGAGGTCCCCTCCTGGG + Intergenic
960941798 3:122939795-122939817 GGGTCAAGGGGTTCCTCCCAGGG - Intronic
961508231 3:127385651-127385673 GGGGCTGAGGGTCCCCTTCATGG + Intergenic
962910952 3:139849066-139849088 GGATGACGGGGTCTCCTCCAAGG + Intergenic
963525423 3:146409471-146409493 TGGTCAGAAGGCCCCCTCCATGG - Intronic
968392800 4:206755-206777 TGGTCAAGGGCTCCCCTACAAGG + Intergenic
968523654 4:1045803-1045825 GGGACATGGGGGCCTCTCCAGGG + Intergenic
968558318 4:1261662-1261684 GGGTCAGAGCGTGCCTTCCAGGG + Intergenic
968652845 4:1766981-1767003 GAGCCGGAGGGTCCCCTCCACGG - Intergenic
969597481 4:8157556-8157578 GGGCCAGGGACTCCCCTCCCTGG - Intronic
975048701 4:69832295-69832317 GGGTCTGGGGCTCCCAGCCATGG - Intronic
984712407 4:182896654-182896676 AGGTCACGGGAGCCCCTCCAAGG - Intronic
985658980 5:1146317-1146339 GGCCCAGGTGGTCACCTCCAGGG - Intergenic
988614724 5:32764357-32764379 GGGCCAGGGGGTACCCTCAAGGG + Intronic
993055500 5:82975200-82975222 GAGTGAGTGGGTCCTCTCCACGG - Intergenic
997727462 5:136133264-136133286 GGGTCAGGGGGTCCCCTCCAGGG - Intronic
998042393 5:138959925-138959947 GAGCCAGGGGGTCCCCAACATGG + Intronic
999369843 5:151048056-151048078 AGGTGAGGGGGAGCCCTCCAAGG + Intronic
1001144245 5:169170043-169170065 GGGTCTGGAGGTTCCCTCCTTGG - Intronic
1002162223 5:177321226-177321248 GTGTCAGGGTGTCCTCTTCAAGG + Intergenic
1002277885 5:178114952-178114974 GGGTCACGGGTTCCCCTCCATGG - Intronic
1002395106 5:178946484-178946506 GGGTAAGTGGGACCCCTGCAAGG + Exonic
1003485897 6:6579510-6579532 GGGTGAGGGGCTTCCCTCCCAGG - Intergenic
1004707057 6:18134372-18134394 GGGTGACTGGGACCCCTCCAGGG + Intronic
1006379353 6:33688599-33688621 GGGGCAGGGGGTGCTCACCAGGG + Intronic
1006618023 6:35342875-35342897 GGGTCAGCGGGGCGCCTACATGG - Intronic
1012054896 6:94393834-94393856 GGGTAAGGCAGTCACCTCCAAGG - Intergenic
1019386158 7:757349-757371 GGGCCAGAGGGTCCCGGCCATGG - Intronic
1019414754 7:922134-922156 GTGTCAGTGCGGCCCCTCCAGGG - Intronic
1019429229 7:991040-991062 GGGCCCGAGGGTCCCCTGCAGGG - Intergenic
1022496540 7:30856432-30856454 GGCTCAAGGGGTCCCCTTGAGGG + Intronic
1023842825 7:44106618-44106640 CGGCCTGGGGGACCCCTCCAAGG - Exonic
1023863413 7:44228075-44228097 GGGGCAGAGGGCACCCTCCAGGG + Intronic
1024573894 7:50748249-50748271 GGGCCACGGGGCCTCCTCCAGGG - Intronic
1027049169 7:75010743-75010765 GGGTAAGGGCTTCCCTTCCAGGG + Intronic
1027746543 7:82082010-82082032 GGGTCAGGGGCACCCCTGCCTGG - Intronic
1029127060 7:98301793-98301815 GCTTCAGGCTGTCCCCTCCACGG - Intronic
1030648437 7:112090932-112090954 GAGTCAGGGGGTCCCTGCCTAGG - Intronic
1031106097 7:117544972-117544994 GGGCCAGTGGGTCCCCACCTAGG + Intronic
1034455342 7:151167254-151167276 GGGTCAGGCTGTGCCCTCGATGG - Exonic
1035072986 7:156158427-156158449 GACACAGGGGGACCCCTCCAGGG + Intergenic
1035528661 8:334548-334570 GGGTTAGGGGCTTTCCTCCAAGG + Intergenic
1037993598 8:23337850-23337872 GAGTCAGGGGCTCCTCACCAAGG - Intronic
1049234773 8:141507037-141507059 GGGTCAGGGGGTCCCTGCTGGGG + Intergenic
1049461695 8:142732479-142732501 CAGTGAGTGGGTCCCCTCCATGG - Intronic
1049520793 8:143089164-143089186 AGCTCTGGGGGACCCCTCCAGGG + Intergenic
1049642375 8:143721501-143721523 GGGTCAGTGGGTCAACCCCAGGG - Intronic
1049673764 8:143880748-143880770 GGAGCAGGGTGTCCCCTCCACGG + Intergenic
1049781227 8:144429868-144429890 GGGGCAGGCTGTGCCCTCCAGGG - Intronic
1051534574 9:18142479-18142501 AGGTGAGGGGGTGCCCTCCATGG - Intergenic
1056788986 9:89613215-89613237 GGGACAGGGGGCTCCTTCCAAGG + Intergenic
1057307568 9:93921058-93921080 GGGTCTGGCGGACACCTCCATGG + Intergenic
1061674496 9:132208160-132208182 GGGTCAGGGAAGGCCCTCCAGGG + Intronic
1062021670 9:134322450-134322472 GAGACAGTGGGTTCCCTCCAGGG - Intronic
1062372128 9:136245441-136245463 GGGTCGGGGGGTCCCCGCGCGGG + Intronic
1187152556 X:16694412-16694434 GGGTCAGAGTCTGCCCTCCAAGG - Intronic
1190260202 X:48792593-48792615 GGGACAGGGGTTCCCATACAGGG - Intronic
1191715720 X:64192356-64192378 GGCTCAGTGGGTCCCCCACAGGG + Exonic
1198174188 X:134138969-134138991 GGGGCAGGGGGTCCCCAAGAGGG + Intergenic
1198742114 X:139852687-139852709 GAGTGAGTGGGTCCTCTCCATGG + Intronic
1199700345 X:150371061-150371083 GGGTCGGGGGTCCTCCTCCAGGG - Intronic