ID: 997727462

View in Genome Browser
Species Human (GRCh38)
Location 5:136133264-136133286
Sequence GGGTCAGGGGGTCCCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997727462_997727476 18 Left 997727462 5:136133264-136133286 CCCTGGAGGGGACCCCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 997727476 5:136133305-136133327 GGTTTGCTTTCCTAACTCATCGG 0: 1
1: 0
2: 1
3: 12
4: 133
997727462_997727472 -3 Left 997727462 5:136133264-136133286 CCCTGGAGGGGACCCCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 997727472 5:136133284-136133306 CCCCGCGCTGTCCTGGGGAGCGG 0: 1
1: 0
2: 1
3: 33
4: 298
997727462_997727466 -10 Left 997727462 5:136133264-136133286 CCCTGGAGGGGACCCCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 997727466 5:136133277-136133299 CCCCTGACCCCGCGCTGTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 192
997727462_997727470 -8 Left 997727462 5:136133264-136133286 CCCTGGAGGGGACCCCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 997727470 5:136133279-136133301 CCTGACCCCGCGCTGTCCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 149
997727462_997727468 -9 Left 997727462 5:136133264-136133286 CCCTGGAGGGGACCCCCTGACCC 0: 1
1: 0
2: 1
3: 22
4: 202
Right 997727468 5:136133278-136133300 CCCTGACCCCGCGCTGTCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997727462 Original CRISPR GGGTCAGGGGGTCCCCTCCA GGG (reversed) Intronic