ID: 997727512

View in Genome Browser
Species Human (GRCh38)
Location 5:136133552-136133574
Sequence TGTCAGTTTTCACCACTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997727509_997727512 -2 Left 997727509 5:136133531-136133553 CCTGGTTTCTGCCACTTGCCATG 0: 1
1: 1
2: 1
3: 15
4: 269
Right 997727512 5:136133552-136133574 TGTCAGTTTTCACCACTGCAAGG 0: 1
1: 0
2: 1
3: 21
4: 200
997727507_997727512 27 Left 997727507 5:136133502-136133524 CCGGCTACTGCAATCAGCTGGTA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 997727512 5:136133552-136133574 TGTCAGTTTTCACCACTGCAAGG 0: 1
1: 0
2: 1
3: 21
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997727512 Original CRISPR TGTCAGTTTTCACCACTGCA AGG Intronic