ID: 997728214

View in Genome Browser
Species Human (GRCh38)
Location 5:136140437-136140459
Sequence CACAGTGTACGAGGGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997728214_997728220 -6 Left 997728214 5:136140437-136140459 CCTTTTCCCCCTCGTACACTGTG 0: 1
1: 0
2: 1
3: 9
4: 128
Right 997728220 5:136140454-136140476 ACTGTGTTCTCAGGCTATACTGG 0: 1
1: 0
2: 0
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997728214 Original CRISPR CACAGTGTACGAGGGGGAAA AGG (reversed) Intronic
902124155 1:14194511-14194533 CACAGACAACGATGGGGAAAGGG - Intergenic
902467356 1:16626343-16626365 CACAGTGTACCTGGGTGACAAGG + Intergenic
903359496 1:22767818-22767840 CTCAGGGTACCAGTGGGAAATGG + Intronic
907021559 1:51071469-51071491 CACAGTCTTGGTGGGGGAAAGGG - Intergenic
908389929 1:63675244-63675266 CGCAGTGTGGGAGGGGGAGAGGG - Intergenic
910217841 1:84860470-84860492 CACATTCTAAGAGGGAGAAATGG - Intronic
914508229 1:148307757-148307779 CACAGTGAAGGAAGGGGAAGTGG + Intergenic
915276982 1:154795853-154795875 CACAGTGTTCCAGGAGGAAATGG + Intronic
918215566 1:182390403-182390425 CCAAGTTTACGTGGGGGAAATGG + Intronic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
922496792 1:226063178-226063200 CCCAGTTTTCGAGCGGGAAAGGG + Intronic
1064145502 10:12823420-12823442 CACAGAGGCCCAGGGGGAAAAGG + Intronic
1065049138 10:21772951-21772973 AACAGAGAGCGAGGGGGAAATGG + Intronic
1065095684 10:22278445-22278467 CACAGTGTTCGAGCGGGCAGCGG + Intergenic
1065247891 10:23777495-23777517 GACAGTGTAAGAAAGGGAAAAGG + Intronic
1068553896 10:58436295-58436317 CACAGTGTTCTTGGGGCAAACGG + Intergenic
1072861459 10:99009541-99009563 AACAGTGGACCAGAGGGAAAAGG + Intronic
1075425918 10:122341631-122341653 CTAATTGTACAAGGGGGAAATGG + Intergenic
1077724630 11:4661659-4661681 CACAGTGTACATGGAGGAGAAGG + Intergenic
1080227641 11:29977594-29977616 CACAGTGTGTTAGTGGGAAAAGG - Intergenic
1081103582 11:39035642-39035664 CACATCGTATGAGGGGAAAAAGG + Intergenic
1082771086 11:57207930-57207952 TGCAGTGAACGAGGGGGAAAAGG + Intergenic
1082791390 11:57348678-57348700 CAAAGTTGAAGAGGGGGAAACGG - Exonic
1086584865 11:88439014-88439036 CAAAGTCTCTGAGGGGGAAATGG + Intergenic
1087286061 11:96266173-96266195 CAGGGTGTACGATGGGGAAGTGG - Intronic
1088605433 11:111525858-111525880 CACAGTGTTCTTGGGGCAAATGG + Intronic
1088687224 11:112295147-112295169 CACAGAGTAGGAAGGGGAAGAGG - Intergenic
1088927946 11:114321208-114321230 CCCAGTGCAGGAGGGGGACAAGG - Intergenic
1093437568 12:19153528-19153550 CACAGTGGGGGAGGGGGTAAAGG - Intronic
1096008331 12:48190347-48190369 CACAGCGTGAGAGAGGGAAAAGG - Intergenic
1096203831 12:49705790-49705812 CACAGTGTTCCAAGGGGAAGTGG - Intronic
1096245004 12:49979590-49979612 CATACTGTGCAAGGGGGAAAAGG + Intronic
1098582432 12:72116004-72116026 CAGAGGGTAAGTGGGGGAAAGGG - Intronic
1106313913 13:28577227-28577249 CACAGTGTTCGGGGGCAAAAAGG + Intergenic
1108420861 13:50248157-50248179 CACAGTGAGCAAGGGGGAAGAGG - Intronic
1114616282 14:24070035-24070057 CCCAGTGTACCAGAGGGACACGG + Intergenic
1117480645 14:56140963-56140985 AATAGAGTACGAGGGGAAAAAGG - Intronic
1123108907 14:105856176-105856198 CACAGGAGACGAGGGGGAAAAGG + Intergenic
1124358827 15:29019214-29019236 CACAGAACAGGAGGGGGAAAGGG - Intronic
1125826516 15:42681225-42681247 CACAGTGCAGGAGGGGAGAATGG - Intronic
1130464067 15:84181857-84181879 CAAAATGTATCAGGGGGAAAAGG - Intronic
1130500200 15:84491684-84491706 CAAAATGTATCAGGGGGAAAAGG + Intergenic
1130586363 15:85186489-85186511 CAAAATGTATCAGGGGGAAAAGG - Intergenic
1130968379 15:88714064-88714086 CACTGTGTAAGTGAGGGAAAGGG + Intergenic
1132428089 15:101737472-101737494 CAAAATGTATGGGGGGGAAAAGG + Intronic
1134687571 16:16169535-16169557 CACACTGTTCCAGGGGGACAGGG + Intronic
1135537261 16:23303563-23303585 GACTGTGTAGGTGGGGGAAAGGG - Intronic
1136559601 16:31031313-31031335 CACAGAGTAGGAGGGGGAAGGGG + Intergenic
1137561048 16:49502646-49502668 CACAGTGTCCCATGGGGAATAGG + Intronic
1140133497 16:72184611-72184633 CACAGAGTACCATGGGGTAAAGG + Intergenic
1141750045 16:85952314-85952336 CCCAGTGAGCGAGGGAGAAATGG + Intergenic
1141753420 16:85975178-85975200 CACAGTGTAAGAGGAGGGAGAGG - Intergenic
1141767177 16:86066403-86066425 CACACTCTGCGAGGGGGATAAGG - Intergenic
1145888314 17:28397729-28397751 CCCAGTGGAGGAGGGGGCAATGG - Exonic
1146662434 17:34673733-34673755 CACAGTGTGGGAGTGGGAATTGG - Intergenic
1147047206 17:37762093-37762115 AGGAGTGTACAAGGGGGAAAGGG - Intergenic
1147183510 17:38701779-38701801 TACAGTCTGCGATGGGGAAACGG + Intergenic
1148355338 17:46972002-46972024 CACAGGGCACGTGGGGGAGAGGG + Intronic
1157218487 18:45806518-45806540 CAAACTGTACAAGTGGGAAAGGG + Intergenic
1157893069 18:51437388-51437410 CTGAGTGTACGGGAGGGAAAGGG - Intergenic
1164454306 19:28394459-28394481 CACAGATTACCAGGGGAAAAAGG - Intergenic
925446658 2:3931922-3931944 CACAATGAACTTGGGGGAAAGGG - Intergenic
926635780 2:15177613-15177635 CACAGTGTACGAGGGTGGGGAGG + Intronic
927449576 2:23195935-23195957 CAAAGTGTAGGAAGGGTAAATGG + Intergenic
933002311 2:76940763-76940785 CACAGTGTAGTAAGGGGAAGTGG - Intronic
933360948 2:81283167-81283189 CACAGTGTGGGAGGTGGAATTGG + Intergenic
935030685 2:99318578-99318600 CACAGTCTACAAGGGGGAAAGGG + Intronic
938940763 2:136167809-136167831 CACAGTGAAAGAGTGGGAATGGG + Intergenic
939525665 2:143290704-143290726 CACAATGTAGGAGGAGGAACAGG + Intronic
939775680 2:146384694-146384716 CACAGTGTAAGAGGGGAGGAAGG + Intergenic
941014570 2:160340474-160340496 CTCAGGGTACATGGGGGAAAGGG + Intronic
943526577 2:189023927-189023949 CACAGTGGACGTTGGGGAATCGG + Intergenic
947880110 2:233501277-233501299 CAGTGAGTAAGAGGGGGAAATGG + Intronic
1170445151 20:16418851-16418873 CACATTGAGGGAGGGGGAAAGGG - Intronic
1174760291 20:53200384-53200406 CACAGTGAACGAAGGAGAGAGGG + Intronic
949809988 3:7996797-7996819 CACAGGGTAACAGGGGGAACAGG - Intergenic
954877528 3:53811882-53811904 CGCAGTGTATTTGGGGGAAAGGG - Exonic
955921383 3:63960265-63960287 GACAGTGTGCAAGGAGGAAAGGG + Intronic
959396618 3:105847636-105847658 CAGTGTGTAGGAGGGGAAAATGG + Intronic
959842910 3:110999138-110999160 GACAGAGCACGTGGGGGAAAGGG + Intergenic
961039677 3:123668847-123668869 CACAGTTTAGGAGGAGGAGAAGG - Intronic
965417676 3:168417258-168417280 CACAGTGTGGGAGGGTAAAAGGG + Intergenic
965420779 3:168455937-168455959 CACATTGTGCAAGGGGGATAAGG - Intergenic
967977363 3:195042985-195043007 GACAATTTACGAAGGGGAAAGGG + Intergenic
971548665 4:27920701-27920723 CACAGTGCTTGAGGGGAAAATGG - Intergenic
972983695 4:44737519-44737541 TACAGTCTAAGAGGGTGAAAGGG + Intergenic
976564049 4:86533227-86533249 CACTGGTTACGAGGGGTAAAAGG + Intronic
977536714 4:98261933-98261955 CTCAGTACACGCGGGGGAAAAGG - Intronic
979617692 4:122762716-122762738 CTCAGTGCAGGAGGTGGAAAAGG + Intergenic
984304171 4:177965609-177965631 CACAGTGTGTGAGGAAGAAATGG - Intronic
985414262 4:189720842-189720864 CACAAGGTACCAGGGGGCAATGG + Intergenic
985531173 5:434567-434589 CACAGTGTGCAGGGTGGAAAGGG - Exonic
986165205 5:5267075-5267097 CACACCCTGCGAGGGGGAAAAGG - Intronic
987704572 5:21446622-21446644 CACAGAGCACCTGGGGGAAAGGG - Intergenic
990223042 5:53617265-53617287 CAGAGAGTAAGAGGGGGGAAAGG - Intronic
991958203 5:72016723-72016745 CACAGTGGACATGGGGGTAAGGG - Intergenic
991965405 5:72085837-72085859 CCCGGTGTACTAGGGTGAAAGGG + Intergenic
996694071 5:126374058-126374080 CACAATGTACCAGGGGAAACAGG - Intronic
997728214 5:136140437-136140459 CACAGTGTACGAGGGGGAAAAGG - Intronic
998747189 5:145273972-145273994 CATAGTGAACGAGAGGGACAGGG + Intergenic
1001989349 5:176103402-176103424 CACAGTGTCCTTGGGGGAAATGG + Intronic
1002203105 5:177542753-177542775 CACAGTGTACTAGGAGGAGATGG - Intronic
1002227523 5:177734736-177734758 CACAGTGTCCTTGAGGGAAATGG - Intronic
1002340325 5:178512508-178512530 CAGAGTGTGCCAGGGAGAAAGGG + Intronic
1004562852 6:16767391-16767413 CACAGTGTAAGGGGGGAACATGG - Intergenic
1005382389 6:25250041-25250063 CACAGTATATTAAGGGGAAATGG + Intergenic
1013750750 6:113402968-113402990 CACAGTGTAATAGAGGTAAAAGG + Intergenic
1015313886 6:131795039-131795061 CACAGCATAAGAGGGTGAAATGG - Intergenic
1016784297 6:147993231-147993253 CAAAGTGAAGGAGGAGGAAAAGG + Intergenic
1020666016 7:11045055-11045077 CAGAATGTAGGATGGGGAAAAGG - Intronic
1023053514 7:36273570-36273592 CACAGAGAAGGAGGGAGAAAGGG + Intronic
1023310066 7:38877323-38877345 CACAGAGAAGGAGGGGTAAAAGG + Intronic
1023787225 7:43719855-43719877 CACAGTGAACAAGGGGAAACTGG + Intronic
1027564229 7:79769752-79769774 AACAGTGAACCAAGGGGAAAAGG - Intergenic
1029609093 7:101617131-101617153 CACAGTGAACAAGGGGGACATGG - Intronic
1030542226 7:110845139-110845161 CACAGTGAATGAAGGTGAAAGGG - Intronic
1033781412 7:144674045-144674067 CACAGTGCAGGAAGGGAAAAGGG + Intronic
1037701375 8:21277358-21277380 CACAGGGGATGAGGGGAAAATGG - Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038144724 8:24884642-24884664 CACAGTGTACGTGGGGAAGCTGG + Intergenic
1039110181 8:34033246-34033268 CATTGTGTAGGAGGGGGGAATGG + Intergenic
1040498369 8:47986669-47986691 CATGGTGTAAGAGGTGGAAAGGG + Intergenic
1040745200 8:50633823-50633845 CACAGTGTAGGAGAGGCTAATGG + Intronic
1041758759 8:61341392-61341414 CACATTGTACGTGTGGAAAATGG - Intronic
1043818806 8:84838092-84838114 CTCAGTTTATGAGGGAGAAAAGG + Intronic
1049042348 8:140122063-140122085 GACAGTGTAGGAGGGAGAGAGGG - Intronic
1053064804 9:35060517-35060539 CACAGGATACTAGGAGGAAAAGG + Exonic
1053374830 9:37596913-37596935 AACAAGGTACGATGGGGAAAGGG - Intronic
1054812545 9:69446524-69446546 CACAGTTTCCTAAGGGGAAATGG - Intronic
1057571039 9:96204341-96204363 CCCAGGGTACTAGGGGGGAAGGG + Intergenic
1058963775 9:110017511-110017533 CACATTGGACGAAGGGGAATGGG + Intronic
1061033905 9:128102911-128102933 CACAGTGGACGGGGGCGAGAGGG - Intronic
1188651127 X:32632757-32632779 CACAGTGTACGAGGTTGAACAGG + Intronic
1190301307 X:49059118-49059140 CCCAGGGTGCGAGGGGGATAAGG + Intronic
1191674725 X:63783094-63783116 AACAGTGTATGAGAGAGAAAAGG - Intronic
1194980304 X:100433546-100433568 CACAGTTTAGGAGGGAGAAAAGG - Intergenic
1195638703 X:107149830-107149852 CACAGAGTGGGAGCGGGAAAAGG + Intronic
1200133787 X:153864977-153864999 CACAGTGGATGAGGGGGGCAAGG - Exonic
1201462312 Y:14239833-14239855 GACAGAGTACCTGGGGGAAAGGG + Intergenic