ID: 997729498

View in Genome Browser
Species Human (GRCh38)
Location 5:136157006-136157028
Sequence AGTATTAATAAAGTAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997729494_997729498 24 Left 997729494 5:136156959-136156981 CCCATGATTAAGCAGCTATGACG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 997729498 5:136157006-136157028 AGTATTAATAAAGTAGTAGAAGG No data
997729493_997729498 25 Left 997729493 5:136156958-136156980 CCCCATGATTAAGCAGCTATGAC 0: 1
1: 0
2: 0
3: 8
4: 76
Right 997729498 5:136157006-136157028 AGTATTAATAAAGTAGTAGAAGG No data
997729492_997729498 26 Left 997729492 5:136156957-136156979 CCCCCATGATTAAGCAGCTATGA 0: 1
1: 0
2: 1
3: 14
4: 121
Right 997729498 5:136157006-136157028 AGTATTAATAAAGTAGTAGAAGG No data
997729491_997729498 27 Left 997729491 5:136156956-136156978 CCCCCCATGATTAAGCAGCTATG 0: 1
1: 0
2: 2
3: 13
4: 78
Right 997729498 5:136157006-136157028 AGTATTAATAAAGTAGTAGAAGG No data
997729495_997729498 23 Left 997729495 5:136156960-136156982 CCATGATTAAGCAGCTATGACGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 997729498 5:136157006-136157028 AGTATTAATAAAGTAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997729498 Original CRISPR AGTATTAATAAAGTAGTAGA AGG Intronic
No off target data available for this crispr