ID: 997732649

View in Genome Browser
Species Human (GRCh38)
Location 5:136192443-136192465
Sequence GGCCCCAGGAGCCACGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997732649_997732653 2 Left 997732649 5:136192443-136192465 CCTTGACCGTGGCTCCTGGGGCC 0: 1
1: 0
2: 2
3: 25
4: 251
Right 997732653 5:136192468-136192490 CGCGCTGCCTACCGCCGCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 63
997732649_997732654 3 Left 997732649 5:136192443-136192465 CCTTGACCGTGGCTCCTGGGGCC 0: 1
1: 0
2: 2
3: 25
4: 251
Right 997732654 5:136192469-136192491 GCGCTGCCTACCGCCGCCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 95
997732649_997732658 14 Left 997732649 5:136192443-136192465 CCTTGACCGTGGCTCCTGGGGCC 0: 1
1: 0
2: 2
3: 25
4: 251
Right 997732658 5:136192480-136192502 CGCCGCCTCGGGGCCGCCCGTGG 0: 1
1: 0
2: 3
3: 53
4: 270
997732649_997732655 4 Left 997732649 5:136192443-136192465 CCTTGACCGTGGCTCCTGGGGCC 0: 1
1: 0
2: 2
3: 25
4: 251
Right 997732655 5:136192470-136192492 CGCTGCCTACCGCCGCCTCGGGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997732649 Original CRISPR GGCCCCAGGAGCCACGGTCA AGG (reversed) Intergenic
900107974 1:993582-993604 GGCCCCCCCAGCCCCGGTCAGGG - Intergenic
900523442 1:3117046-3117068 GCCCCCAGGACCCACGGGAAGGG + Intronic
900527369 1:3135816-3135838 GGCCCAGGGAGCCACGGGGAAGG - Intronic
900600640 1:3501381-3501403 TGCCCCTGGAGCCACGGCCGAGG + Intronic
900604324 1:3517042-3517064 GGCCCCTGGAGCCACGGTAGTGG - Intronic
901051177 1:6426555-6426577 GGCCCCAGGAGCCTCGTGCGTGG - Intronic
901199998 1:7461287-7461309 GACCCCAGGGGCCACGATCTGGG - Intronic
901626143 1:10626307-10626329 GGACCCAGGAGCCACGGCTCTGG - Intronic
901629510 1:10641345-10641367 GGCCCCAGGAGTTATGGCCAGGG - Intronic
901641530 1:10695239-10695261 GGCCCCAGGAGCGCCGGCCTGGG + Intronic
901665235 1:10822533-10822555 GGCCCTTGGAGCCACCATCAGGG + Intergenic
902611837 1:17602368-17602390 GCCCCCAAGAGCCAAGGTCCAGG + Intronic
902632864 1:17715991-17716013 GGACTCTGGAGCCACGGTCCGGG - Intergenic
902709768 1:18230764-18230786 GGCTCCAGGAGTCAAGGTCAGGG + Intronic
902873842 1:19329422-19329444 GGCCCCAGGAGGCTGGGCCAGGG - Intergenic
902988575 1:20170768-20170790 GGACTCAGGAGCCCTGGTCAAGG + Intronic
903654955 1:24943315-24943337 GGCTCCTGGAGACAGGGTCATGG + Intronic
903706345 1:25288589-25288611 TGCCTCTGGAGCCACGGTAAGGG - Intronic
903720892 1:25404777-25404799 TGCCTCTGGAGCCACGGTAAGGG + Intronic
903820043 1:26095006-26095028 GGCCCCAGGGGGCAGGGGCAGGG + Intergenic
904010961 1:27390351-27390373 GGCCCCAAGACTCAGGGTCAGGG - Intergenic
906147530 1:43568925-43568947 GACCCTGGGAGTCACGGTCAGGG - Intronic
906809327 1:48810163-48810185 GTCCCCAGGAGCCAGCCTCAAGG - Intronic
907089326 1:51709716-51709738 GGCCACATGGGCCACTGTCATGG - Intronic
907237335 1:53061696-53061718 GGCCCCATTAGCCACGGCCCAGG + Intergenic
915734124 1:158073966-158073988 GGCCCCTGGAGCCCAAGTCAAGG - Intronic
915908986 1:159900448-159900470 GGCCCCAGGAGCCTGGCCCAGGG + Intergenic
918090752 1:181292164-181292186 GGCACCTGGAGCCATGATCAAGG + Intergenic
918186109 1:182129218-182129240 GGCTCCAGGAGCAGGGGTCAGGG - Intergenic
919726598 1:200888549-200888571 GGCCCCTGGAGCAAGGGTCGGGG + Intergenic
919737093 1:200959503-200959525 GCCCCCTGGAGCCACAGGCAGGG - Intergenic
919822867 1:201483907-201483929 AGCCTCAGGAGCCAGGGTTAAGG + Exonic
920055303 1:203186662-203186684 GGCACCAGGAGCCGTGGGCAAGG - Exonic
920838447 1:209533783-209533805 AGCCCCTGGAGCCAGAGTCATGG - Intergenic
922025249 1:221743118-221743140 GGCCCCAGGACGCCCGGCCAGGG - Intergenic
922677082 1:227559789-227559811 GGGCCCAGGGCCCACGGTCCTGG - Intergenic
922677273 1:227560734-227560756 GGGCCCAGGGCCCACGGTCCTGG - Intergenic
1067751074 10:48971651-48971673 GGCACCAGGAGACAAGGACACGG - Intronic
1068828792 10:61469440-61469462 TACCCCAGAATCCACGGTCAGGG + Intergenic
1069035821 10:63645122-63645144 GGCTGGAGGAACCACGGTCAAGG + Intergenic
1071475797 10:86024115-86024137 GGCCCCATGAGCCATGACCAGGG + Intronic
1071565463 10:86669320-86669342 AGCCCCATGAGCCAGGGTCTTGG - Intronic
1073002713 10:100297333-100297355 GGAACCAGGAGCCATGGACAGGG + Intronic
1075454502 10:122576466-122576488 TGCCCCAGGAGCCTCGGTATAGG - Exonic
1075455055 10:122579645-122579667 TGCCCCAGGAGCCTCGGTATAGG - Exonic
1075455560 10:122582667-122582689 TGCCCCAGGAGCCTCGGTATAGG - Exonic
1075456119 10:122586127-122586149 TGCCCCAGGAGCCTCGGTATAGG - Exonic
1075457170 10:122592339-122592361 TGCCCCAGGAGCCTCGGTATAGG - Exonic
1075457683 10:122595370-122595392 TGCCCCAGGAGCCTCGGTATAGG - Exonic
1075458751 10:122601864-122601886 TGCCCCAGGAGCCTCGGTATAGG - Exonic
1075459382 10:122605923-122605945 TGCCCCAGGAGCCTCGGTATAGG - Exonic
1075460014 10:122609982-122610004 TGCCCCAGGAGCCTCGGTATAGG - Exonic
1075460646 10:122614041-122614063 TGCCCCAGGAGCCTCGGTATAGG - Intronic
1075521457 10:123146104-123146126 TGCCTCCGGAGCCAGGGTCAAGG - Intergenic
1076443413 10:130495779-130495801 GGCTGCAGGAGCCACAGACAGGG - Intergenic
1076631217 10:131853337-131853359 GGCCACGGGAGCCAGGGCCACGG - Intergenic
1076767331 10:132643801-132643823 GGCGCCAGGACCCAAGGTGATGG - Intronic
1076785658 10:132748676-132748698 TGCTCCAGGAGGCACGGTCCTGG - Intronic
1076803627 10:132844342-132844364 GGCCCCAGGATGGACGGTGAGGG + Intronic
1077096588 11:801645-801667 GGTCACAGGAGCCTGGGTCAGGG + Intronic
1077533812 11:3109583-3109605 AGACCCAGGAGCCACTGTCTAGG - Intronic
1078139735 11:8683235-8683257 GGCCACGTGAGCCACGGCCACGG + Exonic
1078856368 11:15208896-15208918 GGCTCCAGGACCAACAGTCAGGG + Intronic
1083365469 11:62139293-62139315 GGCCCCTGGAGTCAAGGTCAAGG - Intronic
1085053379 11:73390963-73390985 GGCCCCAGGATCCAGAGTCCTGG - Intronic
1089139770 11:116276151-116276173 GGCCCCAGGAGCCAGGGCTCAGG - Intergenic
1090376443 11:126292900-126292922 GGCCCCTGGAGCCTCGGTCAGGG - Exonic
1090467166 11:126944782-126944804 GGCCCCAGGAGCAATGGAGAAGG - Intronic
1101303267 12:103503282-103503304 GGGCCCAGGGGCCAGGGCCATGG + Intergenic
1101817170 12:108154073-108154095 GGCACCAGGAGGGAAGGTCAGGG + Intronic
1102180492 12:110909085-110909107 GGCCAGAGGAGCCACAGTTAGGG - Intergenic
1103178467 12:118886354-118886376 GGACTCAGGAGCCACCGTAAAGG - Intergenic
1103565247 12:121812060-121812082 GGCCCCGGGAGCGAGGGTCTGGG + Intronic
1104018765 12:124977628-124977650 GGGACCAGGAGCCATGGTCCAGG + Intronic
1104035069 12:125092256-125092278 GGCACCAGGAGGAGCGGTCAGGG - Intronic
1106957281 13:34954043-34954065 GGCACCAGGAGCCAGTTTCATGG - Intronic
1112114729 13:96339555-96339577 GGGCCCAGGAGCCTATGTCAGGG + Intronic
1113485013 13:110646938-110646960 GGCCCCAGGAGACAGGGTGCTGG - Intronic
1113894514 13:113755154-113755176 GGCTCCGAGAGCCAGGGTCAGGG - Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1113964145 13:114142960-114142982 TGCAGCAGGAGCCAGGGTCACGG - Intergenic
1114073230 14:19131899-19131921 GGCCCCAAGGGCCAGCGTCAGGG + Intergenic
1114089036 14:19268084-19268106 GGCCCCAAGGGCCAGCGTCAGGG - Intergenic
1115957574 14:38798321-38798343 GGCCTCAGGAAACACAGTCATGG - Intergenic
1117954302 14:61110922-61110944 GGCCCCAGGGGCCAGGGGCCAGG + Intergenic
1119735112 14:76976656-76976678 GGCCCCAGGAGACTTGGCCAAGG + Intergenic
1119842022 14:77800330-77800352 GGGCCCAGGTGACAAGGTCATGG - Intronic
1120976896 14:90256796-90256818 GGCCCCAGGATCCCCGGGCAAGG - Intronic
1121121101 14:91376458-91376480 CCCCCCAGGAACCACAGTCAAGG + Intronic
1122328787 14:100899202-100899224 GGCCCCAGAACCCAGAGTCATGG + Intergenic
1122615924 14:103017964-103017986 GGCACCAGGGGCCACTTTCATGG + Intronic
1122771870 14:104101232-104101254 GGCCCCAGCAGCCACGCCCTGGG - Intronic
1124500144 15:30221090-30221112 GGCCCCACCACCCAAGGTCATGG - Intergenic
1124743431 15:32317576-32317598 GGCCCCACCACCCAAGGTCATGG + Intergenic
1125845607 15:42850143-42850165 GGCCACTGCAGCCACTGTCAAGG + Intronic
1128269173 15:66293720-66293742 GCCGCCTGCAGCCACGGTCAGGG + Exonic
1129465846 15:75723814-75723836 GTCCCCAGGACCCTGGGTCAGGG - Intergenic
1129901976 15:79158151-79158173 GGTCCCAAGGGCCAGGGTCAGGG - Intergenic
1130093735 15:80841006-80841028 GGAACCTGGAGCCACGGCCAGGG + Intronic
1131158600 15:90090211-90090233 GGCCTCAGGTTCCACGGTTAGGG - Intronic
1131541341 15:93278044-93278066 GCCACCAGGAGCCAAGGGCATGG - Intergenic
1132067401 15:98743625-98743647 GGCCCCAGAAGCCATGTTGAGGG + Intronic
1132152873 15:99474991-99475013 GGGCCAGGGAGCCACGGCCAGGG - Intergenic
1132354279 15:101159610-101159632 TGCCCCAGGGACCTCGGTCAGGG + Intergenic
1133138610 16:3729082-3729104 GCCCCCAGGACGCACGGGCATGG - Exonic
1138095091 16:54205253-54205275 GGCCTCAGGAGGCAATGTCAGGG + Intergenic
1138456935 16:57126470-57126492 GTCCCCAGGAAGCAAGGTCATGG - Intronic
1139696682 16:68680127-68680149 GGCCCAAGGAACCAGGGGCATGG - Intronic
1142088504 16:88197621-88197643 GGCCCCAGGAACCATGGGGAGGG - Intergenic
1142123976 16:88401056-88401078 GGCCTTATGAGCCAGGGTCAGGG - Intergenic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1143417338 17:6759389-6759411 GGCCCCAGGAGGAATGGACATGG - Intronic
1143972128 17:10803477-10803499 GGCCACAGGATCCCCAGTCAGGG + Intergenic
1146303391 17:31709635-31709657 GCCCCCAGGTGCGACGGCCAGGG + Intergenic
1146519564 17:33515700-33515722 GGTCCTAGGAGCCACGGGCAGGG - Intronic
1147356673 17:39903785-39903807 GGCTCCAGAAGCCAAGGCCAAGG - Intergenic
1148211791 17:45813187-45813209 GGCCTCAGGCGCCACGCTCCTGG - Intronic
1149481297 17:57005469-57005491 GTCCCCAGGAGGCACAGGCAAGG - Intronic
1149507936 17:57211397-57211419 GGTCCCAGGAGGCACCCTCAAGG + Intergenic
1151763697 17:76121686-76121708 AGGCCCAGGGGCCAGGGTCATGG + Intergenic
1152305815 17:79519616-79519638 CCTCCCAGGAGCCAGGGTCAAGG - Intergenic
1152424006 17:80209172-80209194 AGCCCCAGGAGGCAGGGGCAAGG - Exonic
1152562520 17:81085735-81085757 GGGCCCAGCAGGCACGGCCAGGG - Intronic
1152997117 18:418005-418027 GGCCCAAGAAGCCAGGGTGAGGG + Intronic
1153914785 18:9735545-9735567 GGCCACACGAGCCACGGCCATGG - Intronic
1155336827 18:24773534-24773556 GGGCCCAGGGCCCACGGTCATGG - Intergenic
1156463785 18:37336145-37336167 AGCCCCAGGAGCCTCGCTCAGGG + Intronic
1157423193 18:47563083-47563105 GGCACCAGGAGCCAGTTTCATGG - Intergenic
1157547282 18:48555383-48555405 GGCCCAGGGAGCTAAGGTCAAGG + Intronic
1157815581 18:50727544-50727566 TGCCGCAGGAACCACAGTCAAGG - Intronic
1157841053 18:50958797-50958819 GGCAGCAGGAACCACAGTCAAGG - Intergenic
1159104831 18:63994070-63994092 GGACCCAGGAGCCAAGGGGAGGG - Intronic
1160497358 18:79383340-79383362 GGCCCCATGAGTCAGTGTCAGGG - Intergenic
1160528976 18:79552689-79552711 GGCCCCGGGACCCACGGGCGTGG - Intergenic
1160541923 18:79628580-79628602 GGCCCCAGGAGGCAGGGGCAGGG - Intergenic
1160691235 19:461392-461414 GGCCCCGGGAGGCGCGGCCAGGG + Intergenic
1160845449 19:1164156-1164178 GGCCCCGGAAGCCATGGGCAGGG - Intronic
1161163875 19:2775187-2775209 GGCCACTGGAGCCACAGGCACGG + Intronic
1161731321 19:5962534-5962556 GACCCAGGGAGCCATGGTCAGGG + Intronic
1161896027 19:7081092-7081114 GGTCCCAGGAGCCCCTGTCCAGG - Intronic
1162402628 19:10454983-10455005 AGCAACAGGACCCACGGTCAGGG - Intronic
1162411820 19:10510645-10510667 GGCCCCAGGAGGCACTGGCTTGG - Intergenic
1162615664 19:11798624-11798646 GGCCCCAGGTGCCTCCGCCACGG + Exonic
1163241089 19:16064344-16064366 CACCCCAGGAGCCCTGGTCAGGG - Intergenic
1163458429 19:17422375-17422397 GCCCCTGGGAGCCACGGACACGG + Exonic
1163734704 19:18972550-18972572 GGCCCCAAGACCCACGCTGAAGG - Intergenic
1164593269 19:29517743-29517765 GGCCCCAGGACCCATTCTCAGGG + Intergenic
1166704846 19:44903090-44903112 GGCCCCAAGGGCCAGTGTCAGGG - Exonic
926395936 2:12442315-12442337 GGCCCCAGGAGCCACTGAGATGG + Intergenic
927512027 2:23649858-23649880 GGCCCCAGCAGACACCGGCAGGG + Intronic
931204852 2:60137205-60137227 GCTCCCAGGAGCCAGGGGCAAGG - Intergenic
931999186 2:67868210-67868232 GGTCCAAAGAGCCAGGGTCATGG + Intergenic
932591830 2:73072015-73072037 GGCCCCAGGAGCGACGCCCACGG - Intronic
933813528 2:86048196-86048218 GGGCCCAGGAGGCAGGGTGAGGG + Intronic
934579761 2:95428536-95428558 GCCCCCAAGAGCCAGGGTCAGGG + Intergenic
934599686 2:95648189-95648211 GCCCCCAAGAGCCAGGGTCAGGG - Intergenic
936048161 2:109202629-109202651 GGCCCCAGGAACCTGGGTCCTGG + Intronic
936533025 2:113290192-113290214 GGCCCCAAGAGCCAGGGTCAGGG - Intergenic
938370281 2:130764038-130764060 GGCCCCTGGAGGCCAGGTCACGG + Exonic
938487155 2:131723263-131723285 GGCCCCAAGGGCCAGTGTCAGGG + Intronic
941771299 2:169348913-169348935 GGCCCCTGGAGGCCCAGTCAAGG - Intronic
945124176 2:206489750-206489772 GACCACAGCAGCCACGGTGAAGG - Intronic
945411553 2:209515432-209515454 GGCCCCAGGAAACACAATCATGG + Intronic
947823513 2:233088911-233088933 GGGCCCAGGCGCGAGGGTCATGG + Intronic
948146966 2:235715378-235715400 GGCCTCACCAGCCACTGTCAAGG + Intronic
1172062579 20:32196625-32196647 GGCCACAGGAGGCCTGGTCATGG - Exonic
1173078163 20:39840556-39840578 GTCTCCAGGAGCCACAGTCTAGG + Intergenic
1174399692 20:50269432-50269454 GGCCCAAGGAGGAACGGGCAGGG - Intergenic
1175267325 20:57710350-57710372 AGCCCCAAGAGCCTGGGTCAAGG - Intronic
1175749729 20:61487004-61487026 GGGCCCTGGAGTCACAGTCAAGG + Intronic
1176312390 21:5159198-5159220 GGCCCGAGCAGCCACTGGCATGG + Intergenic
1176917432 21:14643812-14643834 GGCCGCAGGTGCCACGGTAGGGG - Intronic
1178753535 21:35326378-35326400 AGACCCAGGACCCAGGGTCAAGG + Intronic
1179844658 21:44102832-44102854 GGCCCGAGCAGCCACTGGCATGG - Exonic
1180491671 22:15854252-15854274 GGCCCCAAGGGCCAGCGTCAGGG + Intergenic
1180671590 22:17557813-17557835 GGCCCCAGGAGCTACGCACAAGG - Intronic
1181052909 22:20246157-20246179 TGGCTCAGGAGCCACAGTCAGGG + Intronic
1183241388 22:36660330-36660352 GCCCGCAGAAGCCATGGTCACGG - Intronic
1183949293 22:41343705-41343727 GGCCCCAGGAGCCTAGGCCGTGG - Intronic
1184411759 22:44330281-44330303 AGCCTCAGGAGCCTTGGTCAAGG + Intergenic
949877417 3:8635320-8635342 GGCCCCAGGAGCAAAGGTCCTGG - Exonic
950200846 3:11042597-11042619 GGCTCACTGAGCCACGGTCAGGG + Intergenic
950683943 3:14603083-14603105 GGCCCAGGGAGCCGCGGGCATGG + Intergenic
953386085 3:42506326-42506348 GGCCAAAGGAGCCACAGTGAAGG - Intronic
953406598 3:42662927-42662949 TGCCCCAGGAGGCAGGGTCTGGG + Intronic
953489626 3:43337686-43337708 GGCCTCAGGAAACACAGTCATGG + Intronic
953883335 3:46702519-46702541 AGGCCCAGGAGCCAGGGCCAGGG + Intronic
953889011 3:46736662-46736684 GGGCCTAGGAGGCACTGTCACGG - Intronic
954855969 3:53643708-53643730 GGCCCCAGGTGCCACGGTACGGG - Intronic
956727698 3:72170093-72170115 GTCCCCAGGAGACATGGGCAGGG - Intergenic
959275900 3:104277372-104277394 TGGCCCAGGAGCCACGCTGATGG + Intergenic
960268001 3:115643326-115643348 GGACCCAGGAAACACAGTCAAGG - Intronic
960972831 3:123151633-123151655 GGTCCCAGCAGCCAGGGTCAGGG - Intronic
961335927 3:126179846-126179868 GGCCCCAGGAGCCACGTTGTGGG + Intronic
961715843 3:128856881-128856903 GCCCCCAGGAGCCCATGTCATGG - Intergenic
964410129 3:156389334-156389356 GGCAAAAGGAGCCAAGGTCATGG - Intronic
966668053 3:182495158-182495180 GTCCCCAGCAGCCATGGTCATGG + Intergenic
966916601 3:184587716-184587738 GCCCCCAGTAGTCAGGGTCAGGG - Intronic
968487535 4:871104-871126 GGCACCAGCACCCCCGGTCACGG + Intronic
968589144 4:1449087-1449109 GTCCCCAGGAGCCCCAGCCAGGG + Intergenic
968619929 4:1599459-1599481 GGCCCCAGGCCCCACAGCCACGG + Intergenic
968720278 4:2197479-2197501 GGCCACAGGAGGCAGGGTCCAGG + Intronic
968742063 4:2336049-2336071 TGCCCCAGGAGGCAGGGGCAGGG + Intronic
968969903 4:3788339-3788361 GGCCCCAGGGGGCACAGGCAGGG + Intergenic
968983886 4:3865159-3865181 GGCCCAGGTAGCCACGGTCCAGG + Intergenic
969248551 4:5952502-5952524 GGCCCCAGGCGGCACAGTCAAGG + Intronic
969333241 4:6492128-6492150 AGCCCCAGGGCCCACTGTCAGGG - Intronic
969340095 4:6535094-6535116 GGCGGCAGGAGCCAGGGTCGGGG + Intronic
969533040 4:7740122-7740144 GGCCACAGGGGACACGGTCGTGG - Intronic
969610829 4:8227070-8227092 GCCCCCAGGAGCCAGCGTCCTGG + Exonic
969687323 4:8683000-8683022 GGCCCCAGCAGACAAAGTCATGG + Intergenic
969693987 4:8724677-8724699 GGACCGAGAGGCCACGGTCAGGG + Intergenic
969715323 4:8865604-8865626 GGTCCCAGGAGCCTGAGTCAGGG + Intronic
976320119 4:83704620-83704642 GGCACCATGAGCCAAGGCCATGG - Intergenic
976390067 4:84497890-84497912 GGCCCCCGAGGCCACGGGCATGG + Exonic
978589006 4:110303875-110303897 TGCCTCAAGAGCCACGTTCAGGG - Intergenic
984813137 4:183813017-183813039 GGCCCCAGAACCCACAGACACGG - Intergenic
984943544 4:184954100-184954122 GGCTCCAGGCGCCACTCTCAAGG + Intergenic
985445433 4:190018928-190018950 GGGCCCAGGGCCCACGGTCCTGG - Intergenic
985496168 5:207685-207707 GCCCCCAGGAGACCCGGACAAGG + Intronic
985534752 5:457727-457749 GGACCCAGGAGCCACCCCCATGG - Intronic
985557796 5:565864-565886 GGCCCCAGCAGCCCCGGGCTGGG + Intergenic
986821325 5:11469923-11469945 GGCCAGAGGAGGCATGGTCAAGG - Intronic
989559585 5:42836023-42836045 GGCCCCAGGAACCATGTTCCAGG + Intronic
992220442 5:74566785-74566807 GGACCCAGGGGCCACAGTCCTGG - Intergenic
994545054 5:101155724-101155746 GGCCCCAGGAAACACAATCATGG + Intergenic
997732649 5:136192443-136192465 GGCCCCAGGAGCCACGGTCAAGG - Intergenic
998164757 5:139836709-139836731 CTCTCCAGGAGCCAGGGTCATGG - Intronic
998761261 5:145434640-145434662 TGCCCCAGAAGCCAGTGTCATGG - Intergenic
999869810 5:155737724-155737746 TGACCCAGAGGCCACGGTCAAGG - Intergenic
1000561225 5:162791919-162791941 GGCCTCAGGAAACACAGTCATGG + Intergenic
1001491899 5:172161917-172161939 GGGCCCAGGAGCCCAGTTCAGGG + Intronic
1004820685 6:19365013-19365035 GGGCCCAGGAACCAAGGGCATGG - Intergenic
1006752516 6:36387588-36387610 GGCCCCAGCAGCCACAGCCAGGG - Exonic
1010444732 6:75937084-75937106 GACCCCAGGAGACAGGGCCAGGG + Intronic
1012382427 6:98635976-98635998 GGCACCAGGTGCCAGGGGCAAGG + Intergenic
1017813284 6:157999551-157999573 GGCCCAGGGAGCCAAGCTCAGGG + Intronic
1018966668 6:168495371-168495393 GGCACCGGGAGCCGCGGACAAGG - Intronic
1019300718 7:302174-302196 GGCCCCAGAAGTCACAGGCAGGG - Intergenic
1019643554 7:2117194-2117216 GGCCCTGGGGGCCACCGTCAGGG + Intronic
1021239427 7:18182094-18182116 GGGCCCAGGAGCCAAGATCTAGG + Intronic
1022982087 7:35613263-35613285 GGGCCCTGGAGCCACCCTCAGGG + Intergenic
1023366188 7:39465580-39465602 GACCCCAGGAGCCACGCGCGAGG - Intronic
1024895872 7:54261341-54261363 GGCCTCAGGAAACACAGTCATGG + Intergenic
1025197714 7:56945439-56945461 GGCCCCAGGACCAAGGGCCATGG - Intergenic
1025674233 7:63631499-63631521 GGCCCCAGGACCAAGGGCCATGG + Intergenic
1029402734 7:100355828-100355850 GGTCCCATGGGCCACGGGCAAGG + Intronic
1033112877 7:138597935-138597957 TGCTCCAGCAGCCAGGGTCAGGG + Intronic
1034957436 7:155343809-155343831 GGCCCCTGGAGCCAAAGACAGGG + Intergenic
1035587379 8:786305-786327 GTCACCAGGAGCCATGGTCCGGG + Intergenic
1036602642 8:10276210-10276232 TGCTCCAGGAGGCACAGTCAGGG - Intronic
1037566861 8:20125434-20125456 GGCCTCAGGAAACACAGTCATGG + Intergenic
1039502962 8:38031297-38031319 GGACCCTGGCGCCACGGCCAGGG + Intronic
1041854710 8:62438425-62438447 GCCCCCAGGAGCCACAGAGAGGG - Intronic
1043399427 8:79869086-79869108 GGCCCCTGGAGCTGTGGTCATGG - Intergenic
1043965538 8:86470525-86470547 GGACCCAGGAGCCACACTCCTGG + Intronic
1046611376 8:116429414-116429436 GGCCTCAGGAAACACAGTCATGG + Intergenic
1048032381 8:130644885-130644907 GACCCCAGAAGCCACGTTTAGGG - Intergenic
1048083214 8:131150954-131150976 GTTCCCAGGACCCAGGGTCAGGG - Intergenic
1049191152 8:141288462-141288484 GTCCCCATCAGACACGGTCAGGG - Intronic
1049229943 8:141476788-141476810 GGCCCCGGGAGCCACGGGGAAGG - Intergenic
1049418378 8:142505798-142505820 GGCCACAGTAGCCAGGGGCACGG + Intronic
1049580824 8:143409756-143409778 GGCCCCAGGAGCAAAGGGCTGGG - Intergenic
1049784363 8:144443579-144443601 GCCTCCAGCAGCCAGGGTCAGGG + Intronic
1054254572 9:62800397-62800419 GGGCCCAGGGCCCACGGTCCTGG + Intergenic
1056793140 9:89639185-89639207 GGCCCCAGGAGCCACACTGCGGG - Intergenic
1057199599 9:93133181-93133203 GGCCCCATGAGCCACGGGATAGG - Intronic
1059051626 9:110932855-110932877 GGCCCCAGGAATCACTTTCATGG - Intronic
1060790612 9:126483132-126483154 GGCCCCAGGAGGCTGGGCCAGGG + Intronic
1061866734 9:133495127-133495149 AGCCCCAGGAGCCGCGGTGATGG + Intergenic
1062489630 9:136798994-136799016 GGCCCCAGGCCCCAGGGTCCAGG - Intronic
1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG + Intronic
1187268092 X:17755598-17755620 CACCCCTGGAGCCTCGGTCAGGG - Intergenic
1187321154 X:18238685-18238707 CACCCCCGGAGCCTCGGTCAGGG + Intergenic
1189249641 X:39590460-39590482 TTCCCCAGGAGCCACAGGCAGGG - Intergenic
1190289899 X:48985441-48985463 GACCCCAGGGGCCAGGGACAGGG + Intronic
1191876859 X:65806645-65806667 GGCCCCAGGATCCCTGGTCAGGG + Intergenic
1200116949 X:153773625-153773647 AGCCCCAGGACCCACAGCCAAGG + Exonic
1200234985 X:154463842-154463864 GGCCCCAGGGGACGCGGCCAAGG + Intronic