ID: 997734274

View in Genome Browser
Species Human (GRCh38)
Location 5:136201958-136201980
Sequence TCTCCAAATCATTTTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997734274_997734280 22 Left 997734274 5:136201958-136201980 CCAGCTCCAAAATGATTTGGAGA No data
Right 997734280 5:136202003-136202025 CTCTGAGAAGGGCATGAAAGAGG No data
997734274_997734278 10 Left 997734274 5:136201958-136201980 CCAGCTCCAAAATGATTTGGAGA No data
Right 997734278 5:136201991-136202013 TCTGAGTCAGTGCTCTGAGAAGG No data
997734274_997734279 11 Left 997734274 5:136201958-136201980 CCAGCTCCAAAATGATTTGGAGA No data
Right 997734279 5:136201992-136202014 CTGAGTCAGTGCTCTGAGAAGGG No data
997734274_997734281 30 Left 997734274 5:136201958-136201980 CCAGCTCCAAAATGATTTGGAGA No data
Right 997734281 5:136202011-136202033 AGGGCATGAAAGAGGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997734274 Original CRISPR TCTCCAAATCATTTTGGAGC TGG (reversed) Intergenic
No off target data available for this crispr