ID: 997735382

View in Genome Browser
Species Human (GRCh38)
Location 5:136209123-136209145
Sequence TGCAGAAGGCAGACCCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997735378_997735382 5 Left 997735378 5:136209095-136209117 CCTGCTCATTCTAGAGGAGGCCA No data
Right 997735382 5:136209123-136209145 TGCAGAAGGCAGACCCAGCCAGG No data
997735377_997735382 6 Left 997735377 5:136209094-136209116 CCCTGCTCATTCTAGAGGAGGCC No data
Right 997735382 5:136209123-136209145 TGCAGAAGGCAGACCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997735382 Original CRISPR TGCAGAAGGCAGACCCAGCC AGG Intergenic
No off target data available for this crispr