ID: 997737495

View in Genome Browser
Species Human (GRCh38)
Location 5:136224783-136224805
Sequence CTGTGGAAGCAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1542
Summary {0: 1, 1: 1, 2: 9, 3: 69, 4: 691}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997737495_997737502 -7 Left 997737495 5:136224783-136224805 CCCTCCACCCTCTGCTTCCACAG 0: 1
1: 1
2: 9
3: 69
4: 691
Right 997737502 5:136224799-136224821 TCCACAGGGCCCAGCTGCCCTGG 0: 1
1: 0
2: 7
3: 58
4: 521
997737495_997737510 22 Left 997737495 5:136224783-136224805 CCCTCCACCCTCTGCTTCCACAG 0: 1
1: 1
2: 9
3: 69
4: 691
Right 997737510 5:136224828-136224850 CACCCTTCTCTTCCTCTGCCTGG 0: 1
1: 0
2: 10
3: 60
4: 529
997737495_997737513 26 Left 997737495 5:136224783-136224805 CCCTCCACCCTCTGCTTCCACAG 0: 1
1: 1
2: 9
3: 69
4: 691
Right 997737513 5:136224832-136224854 CTTCTCTTCCTCTGCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997737495 Original CRISPR CTGTGGAAGCAGAGGGTGGA GGG (reversed) Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900518426 1:3094259-3094281 CTGTGGAGGCAGGGTGGGGATGG - Intronic
900518426 1:3094259-3094281 CTGTGGAGGCAGGGTGGGGATGG - Intronic
900585711 1:3431330-3431352 GGCTGGAAGCAGAGTGTGGAGGG + Intronic
900585711 1:3431330-3431352 GGCTGGAAGCAGAGTGTGGAGGG + Intronic
900607099 1:3528657-3528679 GCGTGGAAGCAGAGGTCGGAGGG + Intronic
900607099 1:3528657-3528679 GCGTGGAAGCAGAGGTCGGAGGG + Intronic
900610267 1:3541748-3541770 CAGTGGCAGCAGAGAGTGGGCGG + Intronic
900610267 1:3541748-3541770 CAGTGGCAGCAGAGAGTGGGCGG + Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901813179 1:11779142-11779164 CTGTGAAGGCCAAGGGTGGAAGG - Intronic
901813179 1:11779142-11779164 CTGTGAAGGCCAAGGGTGGAAGG - Intronic
902108288 1:14056367-14056389 CGATGGAAGCAGAGCTTGGAGGG + Intergenic
902108288 1:14056367-14056389 CGATGGAAGCAGAGCTTGGAGGG + Intergenic
902398998 1:16147341-16147363 CTGTTGAGGGAGAGGTTGGAGGG - Intronic
902398998 1:16147341-16147363 CTGTTGAGGGAGAGGTTGGAGGG - Intronic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903618735 1:24682188-24682210 CTCCGGAAGCAGAGGTTGCAGGG - Intergenic
903618735 1:24682188-24682210 CTCCGGAAGCAGAGGTTGCAGGG - Intergenic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904076891 1:27850087-27850109 CTGTAGAAGAAGCGTGTGGAGGG + Exonic
904076891 1:27850087-27850109 CTGTAGAAGAAGCGTGTGGAGGG + Exonic
904461318 1:30682037-30682059 CTGTGGCGGCAGAGGCGGGATGG + Intergenic
904461318 1:30682037-30682059 CTGTGGCGGCAGAGGCGGGATGG + Intergenic
904779622 1:32935820-32935842 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
904779622 1:32935820-32935842 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905092728 1:35442364-35442386 CTGTGGAGGGAGAGGCTGGGAGG + Intronic
905092728 1:35442364-35442386 CTGTGGAGGGAGAGGCTGGGAGG + Intronic
905168302 1:36096425-36096447 AATTGGAACCAGAGGGTGGAAGG + Exonic
905168302 1:36096425-36096447 AATTGGAACCAGAGGGTGGAAGG + Exonic
905271871 1:36792670-36792692 CTGCTGAAGGAGTGGGTGGACGG + Intergenic
905271871 1:36792670-36792692 CTGCTGAAGGAGTGGGTGGACGG + Intergenic
905913041 1:41666884-41666906 TGGTGGGAGCATAGGGTGGATGG - Intronic
905913041 1:41666884-41666906 TGGTGGGAGCATAGGGTGGATGG - Intronic
906674587 1:47684034-47684056 GTGTGCAAACAGTGGGTGGATGG + Intergenic
906674587 1:47684034-47684056 GTGTGCAAACAGTGGGTGGATGG + Intergenic
906727492 1:48054729-48054751 CTGTGGGAGCTGGGGGTCGAGGG + Intergenic
906727492 1:48054729-48054751 CTGTGGGAGCTGGGGGTCGAGGG + Intergenic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907714374 1:56913818-56913840 GGGTTGAAGCACAGGGTGGAGGG + Intronic
907714374 1:56913818-56913840 GGGTTGAAGCACAGGGTGGAGGG + Intronic
908042707 1:60132202-60132224 CCATGGAAGCAAAGGTTGGAAGG + Intergenic
908042707 1:60132202-60132224 CCATGGAAGCAAAGGTTGGAAGG + Intergenic
908304653 1:62799952-62799974 CCATGGAGGCAGAGAGTGGAAGG - Intronic
908304653 1:62799952-62799974 CCATGGAGGCAGAGAGTGGAAGG - Intronic
908466711 1:64403099-64403121 CTGCGGAGGCAGAAGATGGAGGG + Intergenic
908466711 1:64403099-64403121 CTGCGGAGGCAGAAGATGGAGGG + Intergenic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
909245354 1:73274146-73274168 CTGTAGGAGCAGAGGTGGGAAGG + Intergenic
909245354 1:73274146-73274168 CTGTAGGAGCAGAGGTGGGAAGG + Intergenic
909473808 1:76059516-76059538 CAGTGAAAGCAGCGGGTGGGAGG + Intergenic
909473808 1:76059516-76059538 CAGTGAAAGCAGCGGGTGGGAGG + Intergenic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
910195762 1:84638116-84638138 TTGTGGAAGTAGGGGTTGGAAGG + Intergenic
910195762 1:84638116-84638138 TTGTGGAAGTAGGGGTTGGAAGG + Intergenic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
912420089 1:109536786-109536808 CTGGGGCAGAAAAGGGTGGATGG + Intergenic
912420089 1:109536786-109536808 CTGGGGCAGAAAAGGGTGGATGG + Intergenic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912837645 1:113010469-113010491 CTCTGGAAGCGGAGGTTGCAAGG - Intergenic
912837645 1:113010469-113010491 CTCTGGAAGCGGAGGTTGCAAGG - Intergenic
913452062 1:118999284-118999306 CTGCGGACTCAGTGGGTGGAGGG - Intergenic
913452062 1:118999284-118999306 CTGCGGACTCAGTGGGTGGAGGG - Intergenic
914647034 1:149663146-149663168 GTGTGGAGGCAGGGGGTGTATGG - Intergenic
914647034 1:149663146-149663168 GTGTGGAGGCAGGGGGTGTATGG - Intergenic
914804664 1:150983315-150983337 CTGTGGGAGCACAGGGTAGTTGG - Intronic
914804664 1:150983315-150983337 CTGTGGGAGCACAGGGTAGTTGG - Intronic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915141760 1:153772446-153772468 CACTGGACGCCGAGGGTGGAAGG - Intronic
915141760 1:153772446-153772468 CACTGGACGCCGAGGGTGGAAGG - Intronic
915413908 1:155725325-155725347 GTGTGGAAGGAGTGGGTGGGGGG - Intronic
915413908 1:155725325-155725347 GTGTGGAAGGAGTGGGTGGGGGG - Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
916897640 1:169182110-169182132 CTCTGGAAGCTGAGGCAGGAAGG - Intronic
916897640 1:169182110-169182132 CTCTGGAAGCTGAGGCAGGAAGG - Intronic
917392358 1:174552314-174552336 GGGTGGAGGCGGAGGGTGGAAGG - Intronic
917392358 1:174552314-174552336 GGGTGGAGGCGGAGGGTGGAAGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
920363830 1:205437642-205437664 TTGTGGAACCAGAGGGTCGCAGG - Intronic
920363830 1:205437642-205437664 TTGTGGAACCAGAGGGTCGCAGG - Intronic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
921061940 1:211592544-211592566 CGGTGGAATCTGAGGGTGGTGGG - Intergenic
921061940 1:211592544-211592566 CGGTGGAATCTGAGGGTGGTGGG - Intergenic
922005942 1:221530848-221530870 TTGTGGAAGCCAAGGGAGGAAGG - Intergenic
922005942 1:221530848-221530870 TTGTGGAAGCCAAGGGAGGAAGG - Intergenic
922228009 1:223662371-223662393 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
922228009 1:223662371-223662393 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
922428029 1:225517746-225517768 ATGGGGAAGAACAGGGTGGAAGG + Intronic
922428029 1:225517746-225517768 ATGGGGAAGAACAGGGTGGAAGG + Intronic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
924157934 1:241200610-241200632 CTGTGAAACAAGAGGTTGGAGGG - Intronic
924157934 1:241200610-241200632 CTGTGAAACAAGAGGTTGGAGGG - Intronic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1062796489 10:348425-348447 GTGTGGAGGCAGAGGCTGGATGG - Intronic
1062796489 10:348425-348447 GTGTGGAGGCAGAGGCTGGATGG - Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063084835 10:2806965-2806987 CCGTGGAAGGAGACCGTGGAGGG + Intergenic
1063084835 10:2806965-2806987 CCGTGGAAGGAGACCGTGGAGGG + Intergenic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063549094 10:7012103-7012125 CAGTTGAAGCAGAGGCTGTATGG - Intergenic
1063549094 10:7012103-7012125 CAGTTGAAGCAGAGGCTGTATGG - Intergenic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1063612804 10:7577016-7577038 CAGTGGAAGCACAGGGAGGGAGG + Intronic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1065684916 10:28274627-28274649 CTGTGTAAACACTGGGTGGATGG - Intronic
1065684916 10:28274627-28274649 CTGTGTAAACACTGGGTGGATGG - Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065972346 10:30815619-30815641 CTGTGAAAGCAGAGGCTCGAGGG - Intergenic
1065972346 10:30815619-30815641 CTGTGAAAGCAGAGGCTCGAGGG - Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067332599 10:45335247-45335269 CTGTGGAAACAGTGAGTAGAAGG - Intergenic
1067332599 10:45335247-45335269 CTGTGGAAACAGTGAGTAGAAGG - Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069923596 10:71832698-71832720 TTGTGGAAACAGAGGGTCAAGGG + Intronic
1069923596 10:71832698-71832720 TTGTGGAAACAGAGGGTCAAGGG + Intronic
1070342335 10:75509378-75509400 CTGTGGAAGCAGAAAGTAAAAGG - Intronic
1070342335 10:75509378-75509400 CTGTGGAAGCAGAAAGTAAAAGG - Intronic
1070655444 10:78267973-78267995 CAATGGAAGCACAGGTTGGAGGG + Intergenic
1070655444 10:78267973-78267995 CAATGGAAGCACAGGTTGGAGGG + Intergenic
1071815641 10:89229866-89229888 GTGTGGGGGCAGAGGGTGTATGG + Intronic
1071815641 10:89229866-89229888 GTGTGGGGGCAGAGGGTGTATGG + Intronic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072450389 10:95534882-95534904 TTGGGGAAGCACAGAGTGGAGGG - Intronic
1072450389 10:95534882-95534904 TTGGGGAAGCACAGAGTGGAGGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072708511 10:97699736-97699758 CTTTGGAAGCCCAAGGTGGAAGG - Intergenic
1072708511 10:97699736-97699758 CTTTGGAAGCCCAAGGTGGAAGG - Intergenic
1072741546 10:97912927-97912949 CTGCTGATGCAGAGGGTGCAGGG - Intronic
1072741546 10:97912927-97912949 CTGCTGATGCAGAGGGTGCAGGG - Intronic
1073077633 10:100834698-100834720 TGGTTGAGGCAGAGGGTGGAAGG + Intergenic
1073077633 10:100834698-100834720 TGGTTGAGGCAGAGGGTGGAAGG + Intergenic
1074642605 10:115404401-115404423 ATGAGGAAACAGAGGGTGTATGG - Intronic
1074642605 10:115404401-115404423 ATGAGGAAACAGAGGGTGTATGG - Intronic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1075594766 10:123720915-123720937 TGGTGGAAGAAGATGGTGGAAGG + Intronic
1075594766 10:123720915-123720937 TGGTGGAAGAAGATGGTGGAAGG + Intronic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1076422448 10:130340902-130340924 ATGTAGAAGCAGAGGGCGGTGGG - Intergenic
1076422448 10:130340902-130340924 ATGTAGAAGCAGAGGGCGGTGGG - Intergenic
1076510750 10:131012225-131012247 CTGTGGAAGCCGCGTGTGGGGGG + Intergenic
1076510750 10:131012225-131012247 CTGTGGAAGCCGCGTGTGGGGGG + Intergenic
1077017688 11:404222-404244 CTGTCGGGGCTGAGGGTGGAGGG - Exonic
1077017688 11:404222-404244 CTGTCGGGGCTGAGGGTGGAGGG - Exonic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077282530 11:1752180-1752202 CTGTGGCAGCTGTGGCTGGAGGG + Intronic
1077282530 11:1752180-1752202 CTGTGGCAGCTGTGGCTGGAGGG + Intronic
1077735119 11:4782831-4782853 CTGTGGCTTCAGAGGGTGCAAGG + Intronic
1077735119 11:4782831-4782853 CTGTGGCTTCAGAGGGTGCAAGG + Intronic
1078043737 11:7893703-7893725 TTGTTGGAGCAGAGAGTGGATGG + Intergenic
1078043737 11:7893703-7893725 TTGTTGGAGCAGAGAGTGGATGG + Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1079110228 11:17601273-17601295 ATGTGGCAGGAGAGGGTGCAGGG + Intronic
1079110228 11:17601273-17601295 ATGTGGCAGGAGAGGGTGCAGGG + Intronic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1080683355 11:34496060-34496082 GGGTGGAAGCAGAGAGGGGAGGG - Intronic
1080683355 11:34496060-34496082 GGGTGGAAGCAGAGAGGGGAGGG - Intronic
1080913144 11:36625999-36626021 GTGTGGAAGCTGAGGTTAGAGGG + Intronic
1080913144 11:36625999-36626021 GTGTGGAAGCTGAGGTTAGAGGG + Intronic
1081520138 11:43873537-43873559 AGGTGGAAGCAGAGCTTGGAGGG - Intergenic
1081520138 11:43873537-43873559 AGGTGGAAGCAGAGCTTGGAGGG - Intergenic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082872903 11:57960184-57960206 CTGAGGAAGCAAAGGGAGGTGGG - Intergenic
1082872903 11:57960184-57960206 CTGAGGAAGCAAAGGGAGGTGGG - Intergenic
1083331136 11:61898932-61898954 CTGTGGGGGGAGGGGGTGGAGGG + Intronic
1083331136 11:61898932-61898954 CTGTGGGGGGAGGGGGTGGAGGG + Intronic
1083683080 11:64360140-64360162 CTGTGGGAGCAGCGAGTGGGTGG - Intronic
1083683080 11:64360140-64360162 CTGTGGGAGCAGCGAGTGGGTGG - Intronic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084434293 11:69129812-69129834 CGATGGAAGCAGAGGTTGGGGGG + Intergenic
1084434293 11:69129812-69129834 CGATGGAAGCAGAGGTTGGGGGG + Intergenic
1084468108 11:69339161-69339183 CTGTGGGGGAAGAGGGTGGGTGG - Intronic
1084468108 11:69339161-69339183 CTGTGGGGGAAGAGGGTGGGTGG - Intronic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085250448 11:75140283-75140305 CTGTGGAGGGAGACAGTGGATGG - Intronic
1085250448 11:75140283-75140305 CTGTGGAGGGAGACAGTGGATGG - Intronic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087906965 11:103709657-103709679 ATGTTGAAGCAGAGGCTGGGTGG - Intergenic
1087906965 11:103709657-103709679 ATGTTGAAGCAGAGGCTGGGTGG - Intergenic
1088454808 11:110022469-110022491 CTGTGGAAGGAAAGGGGAGATGG - Intergenic
1088454808 11:110022469-110022491 CTGTGGAAGGAAAGGGGAGATGG - Intergenic
1089065619 11:115659811-115659833 CTGCGGAAGCAGAGGCTGCGGGG + Intergenic
1089065619 11:115659811-115659833 CTGCGGAAGCAGAGGCTGCGGGG + Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089540203 11:119185373-119185395 CTGTGGAAGCAGTGGGGTAATGG - Intergenic
1089540203 11:119185373-119185395 CTGTGGAAGCAGTGGGGTAATGG - Intergenic
1089603894 11:119630650-119630672 CTGTGGAAGCACAGGGCCAAAGG - Intronic
1089603894 11:119630650-119630672 CTGTGGAAGCACAGGGCCAAAGG - Intronic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1091749591 12:3014155-3014177 CTGTGGAAGCTGAGGCTGAGAGG - Intronic
1091749591 12:3014155-3014177 CTGTGGAAGCTGAGGCTGAGAGG - Intronic
1091960689 12:4691718-4691740 CCCTGGAAGCAGAGGGTGGTGGG + Exonic
1091960689 12:4691718-4691740 CCCTGGAAGCAGAGGGTGGTGGG + Exonic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1093053455 12:14531704-14531726 CCCTGGAAGCAGAGGTTGCAGGG - Intronic
1093053455 12:14531704-14531726 CCCTGGAAGCAGAGGTTGCAGGG - Intronic
1094103080 12:26784361-26784383 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1094103080 12:26784361-26784383 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1094646418 12:32328870-32328892 CTGTGGAAACAGGAGATGGAGGG + Intronic
1094646418 12:32328870-32328892 CTGTGGAAACAGGAGATGGAGGG + Intronic
1095384267 12:41631693-41631715 CTGTGTAAGCTGAGGTGGGATGG + Intergenic
1095384267 12:41631693-41631715 CTGTGTAAGCTGAGGTGGGATGG + Intergenic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096522263 12:52191164-52191186 CTGTGGGACCAGAGGCTTGAGGG + Intronic
1096522263 12:52191164-52191186 CTGTGGGACCAGAGGCTTGAGGG + Intronic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1096684317 12:53277709-53277731 TTGTGGAAGCAGTGGGAGGTTGG + Intronic
1096684317 12:53277709-53277731 TTGTGGAAGCAGTGGGAGGTTGG + Intronic
1096867116 12:54571176-54571198 AAGTGGAGGCAGAGGATGGATGG - Intronic
1096867116 12:54571176-54571198 AAGTGGAGGCAGAGGATGGATGG - Intronic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097773621 12:63620171-63620193 CTGGGGAAGCAGAGAGTAAATGG - Intronic
1097773621 12:63620171-63620193 CTGGGGAAGCAGAGAGTAAATGG - Intronic
1098328364 12:69326024-69326046 CTGGGGAGGCAGAGGTTGCAGGG + Intergenic
1098328364 12:69326024-69326046 CTGGGGAGGCAGAGGTTGCAGGG + Intergenic
1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG + Intronic
1098353352 12:69585863-69585885 CTGAGCCATCAGAGGGTGGAGGG + Intronic
1099750025 12:86761748-86761770 AGATGGAAGCAGAGGTTGGAGGG - Intronic
1099750025 12:86761748-86761770 AGATGGAAGCAGAGGTTGGAGGG - Intronic
1099924120 12:88996679-88996701 CTGTGGAAGGAGAGAGTAAAAGG - Intergenic
1099924120 12:88996679-88996701 CTGTGGAAGGAGAGAGTAAAAGG - Intergenic
1100024161 12:90107365-90107387 CTGGGAAAGTAGAGGGTGGGAGG + Intergenic
1100024161 12:90107365-90107387 CTGGGAAAGTAGAGGGTGGGAGG + Intergenic
1100359252 12:93861152-93861174 CTGAGGGAGCAGAGGCTGCAGGG + Intronic
1100359252 12:93861152-93861174 CTGAGGGAGCAGAGGCTGCAGGG + Intronic
1100386659 12:94110128-94110150 CTGTGGAATTACAGGTTGGAAGG + Intergenic
1100386659 12:94110128-94110150 CTGTGGAATTACAGGTTGGAAGG + Intergenic
1101652938 12:106694270-106694292 CTGTGGAAGTACAGGATGGAAGG - Intronic
1101652938 12:106694270-106694292 CTGTGGAAGTACAGGATGGAAGG - Intronic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102147321 12:110664160-110664182 CTCGGGAAGCTGAGGCTGGAAGG - Intronic
1102147321 12:110664160-110664182 CTCGGGAAGCTGAGGCTGGAAGG - Intronic
1102150672 12:110687648-110687670 GGGTGGAAGTAGGGGGTGGAGGG + Intronic
1102150672 12:110687648-110687670 GGGTGGAAGTAGGGGGTGGAGGG + Intronic
1102208610 12:111107620-111107642 GTGAGGGAGCAGAGGGTGCAGGG + Intronic
1102208610 12:111107620-111107642 GTGAGGGAGCAGAGGGTGCAGGG + Intronic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1102697715 12:114813250-114813272 CTGAGGAAGCAGAGGAAGTAGGG - Intergenic
1102697715 12:114813250-114813272 CTGAGGAAGCAGAGGAAGTAGGG - Intergenic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1103900034 12:124298688-124298710 GTGTGGCAGCAGCAGGTGGATGG + Intronic
1103900034 12:124298688-124298710 GTGTGGCAGCAGCAGGTGGATGG + Intronic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1103936725 12:124481087-124481109 CTGAGGAAGCAGGGGGTGAAGGG + Intronic
1103936725 12:124481087-124481109 CTGAGGAAGCAGGGGGTGAAGGG + Intronic
1104318859 12:127731189-127731211 CTGTGGATGCAGAGTGAGCAAGG - Intergenic
1104318859 12:127731189-127731211 CTGTGGATGCAGAGTGAGCAAGG - Intergenic
1104437189 12:128765723-128765745 CTGTGGGAGCAGAGTGGGAAAGG - Intergenic
1104437189 12:128765723-128765745 CTGTGGGAGCAGAGTGGGAAAGG - Intergenic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1105400088 13:20084118-20084140 CTCAGGAGGCAGAGGGTGGGAGG - Intronic
1105400088 13:20084118-20084140 CTCAGGAGGCAGAGGGTGGGAGG - Intronic
1105446473 13:20461900-20461922 TTGTGGGAGGAGAGGGTGGGAGG + Intronic
1105446473 13:20461900-20461922 TTGTGGGAGGAGAGGGTGGGAGG + Intronic
1106077684 13:26475384-26475406 CTGGGGAAGCAAGGGGGGGAGGG + Intergenic
1106077684 13:26475384-26475406 CTGGGGAAGCAAGGGGGGGAGGG + Intergenic
1106235017 13:27854049-27854071 CTGTGGAAGGAAAGGAGGGAGGG - Intergenic
1106235017 13:27854049-27854071 CTGTGGAAGGAAAGGAGGGAGGG - Intergenic
1106658332 13:31771479-31771501 CTATGGATGGAGAGGGGGGATGG - Intronic
1106658332 13:31771479-31771501 CTATGGATGGAGAGGGGGGATGG - Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108813388 13:54259345-54259367 TTGTGGGAGCAGATAGTGGAAGG - Intergenic
1108813388 13:54259345-54259367 TTGTGGGAGCAGATAGTGGAAGG - Intergenic
1111812299 13:93106116-93106138 CTGTTTAAGCAGAGGTTGAAGGG + Intergenic
1111812299 13:93106116-93106138 CTGTTTAAGCAGAGGTTGAAGGG + Intergenic
1112437154 13:99398751-99398773 CTGTGGAAATAAAGGGTGGAGGG - Intergenic
1112437154 13:99398751-99398773 CTGTGGAAATAAAGGGTGGAGGG - Intergenic
1113140280 13:107140169-107140191 CTGTGAAAGCAGACTGTGGTAGG - Intergenic
1113140280 13:107140169-107140191 CTGTGAAAGCAGACTGTGGTAGG - Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113971294 13:114192320-114192342 GTGTGGATGCAGAGGGTATATGG + Intergenic
1113971294 13:114192320-114192342 GTGTGGATGCAGAGGGTATATGG + Intergenic
1114198930 14:20505324-20505346 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1114198930 14:20505324-20505346 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1114270465 14:21097828-21097850 CTCTGGAAGCACGGGGTGGCGGG - Intronic
1114270465 14:21097828-21097850 CTCTGGAAGCACGGGGTGGCGGG - Intronic
1116147927 14:41099567-41099589 CTGTGACTTCAGAGGGTGGAAGG + Intergenic
1116147927 14:41099567-41099589 CTGTGACTTCAGAGGGTGGAAGG + Intergenic
1116435082 14:44887339-44887361 GTGTGGACGCAGGGTGTGGATGG + Intergenic
1116435082 14:44887339-44887361 GTGTGGACGCAGGGTGTGGATGG + Intergenic
1117403070 14:55375428-55375450 CTGTGGAGGCTGAGGTGGGAGGG - Intronic
1117403070 14:55375428-55375450 CTGTGGAGGCTGAGGTGGGAGGG - Intronic
1117503363 14:56376053-56376075 CTGTGAAAGAAGGGGGTGGGGGG - Intergenic
1117503363 14:56376053-56376075 CTGTGAAAGAAGGGGGTGGGGGG - Intergenic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118198519 14:63650499-63650521 CTTTGAAACCAGAGGGTGGGTGG + Intergenic
1118198519 14:63650499-63650521 CTTTGAAACCAGAGGGTGGGTGG + Intergenic
1118253650 14:64185762-64185784 CTTTGGAAGCCCAAGGTGGACGG - Intronic
1118253650 14:64185762-64185784 CTTTGGAAGCCCAAGGTGGACGG - Intronic
1118731607 14:68670692-68670714 CAGTGGAAGATGAGAGTGGATGG - Intronic
1118731607 14:68670692-68670714 CAGTGGAAGATGAGAGTGGATGG - Intronic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119414026 14:74457472-74457494 ATGTGGCCGCAGAGGATGGAAGG - Intergenic
1119414026 14:74457472-74457494 ATGTGGCCGCAGAGGATGGAAGG - Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1121015061 14:90544073-90544095 CTGTGGAGGCTCAGAGTGGAAGG + Intronic
1121015061 14:90544073-90544095 CTGTGGAGGCTCAGAGTGGAAGG + Intronic
1121161965 14:91751801-91751823 TTTTGGAAGCACAGGATGGAGGG - Intronic
1121161965 14:91751801-91751823 TTTTGGAAGCACAGGATGGAGGG - Intronic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122060121 14:99131716-99131738 GTGTGCAGGCAGAGGCTGGAGGG + Intergenic
1122060121 14:99131716-99131738 GTGTGCAGGCAGAGGCTGGAGGG + Intergenic
1122232624 14:100314287-100314309 CTGTGCAAACGGAGGGTGGCAGG + Intergenic
1122232624 14:100314287-100314309 CTGTGCAAACGGAGGGTGGCAGG + Intergenic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122703680 14:103607079-103607101 AGGTGGAGGCAGAGGCTGGAGGG + Intronic
1122703680 14:103607079-103607101 AGGTGGAGGCAGAGGCTGGAGGG + Intronic
1122723287 14:103734334-103734356 CCGTGGCAGCGGAGGGTGGTTGG - Exonic
1122723287 14:103734334-103734356 CCGTGGCAGCGGAGGGTGGTTGG - Exonic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123755179 15:23392303-23392325 CTCTGGAAGCTGAGGTTGGAAGG - Intergenic
1123755179 15:23392303-23392325 CTCTGGAAGCTGAGGTTGGAAGG - Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1125170209 15:36758247-36758269 CTTTGGAGGTAGAGGGTGTAGGG - Intronic
1125170209 15:36758247-36758269 CTTTGGAGGTAGAGGGTGTAGGG - Intronic
1125400722 15:39299779-39299801 TTGGGGAAGCAGAGGGTGGGGGG + Intergenic
1125400722 15:39299779-39299801 TTGGGGAAGCAGAGGGTGGGGGG + Intergenic
1125802860 15:42465518-42465540 CTTTGGGAGCCCAGGGTGGAAGG - Intronic
1125802860 15:42465518-42465540 CTTTGGGAGCCCAGGGTGGAAGG - Intronic
1126691028 15:51289085-51289107 TTGTGGAAGGACAGGGTGGTGGG + Intronic
1126691028 15:51289085-51289107 TTGTGGAAGGACAGGGTGGTGGG + Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127574701 15:60279594-60279616 CTGAGGAAGCAGAGAGTGCTAGG - Intergenic
1127574701 15:60279594-60279616 CTGAGGAAGCAGAGAGTGCTAGG - Intergenic
1127586698 15:60384723-60384745 CTGTGAAAGCACAGGTTGTATGG - Intronic
1127586698 15:60384723-60384745 CTGTGAAAGCACAGGTTGTATGG - Intronic
1128214073 15:65922412-65922434 CTGTGCACGCAGAGGGGGCATGG + Exonic
1128214073 15:65922412-65922434 CTGTGCACGCAGAGGGGGCATGG + Exonic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1130063571 15:80586983-80587005 CTGGGGAGGAAGAGGGTGCATGG - Intronic
1130063571 15:80586983-80587005 CTGGGGAGGAAGAGGGTGCATGG - Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1132061367 15:98694859-98694881 GTGTGTAAGCAGTGCGTGGAAGG + Intronic
1132061367 15:98694859-98694881 GTGTGTAAGCAGTGCGTGGAAGG + Intronic
1132130536 15:99273914-99273936 CTAGGGAACCAGTGGGTGGAGGG - Intronic
1132130536 15:99273914-99273936 CTAGGGAACCAGTGGGTGGAGGG - Intronic
1132614336 16:832755-832777 CTGAGGATCCACAGGGTGGACGG - Intergenic
1132614336 16:832755-832777 CTGAGGATCCACAGGGTGGACGG - Intergenic
1132854125 16:2037246-2037268 CTGAGGAGGCAGAGACTGGAGGG - Intronic
1132854125 16:2037246-2037268 CTGAGGAGGCAGAGACTGGAGGG - Intronic
1133207497 16:4242119-4242141 CCGTGGCAGCAGGCGGTGGAGGG + Intergenic
1133207497 16:4242119-4242141 CCGTGGCAGCAGGCGGTGGAGGG + Intergenic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1133302812 16:4793169-4793191 GCCTGGAAGCAGAGGGTGGAGGG + Intronic
1133317530 16:4893674-4893696 CTGTGGGTGCAGGGGGTGGTGGG - Intronic
1133317530 16:4893674-4893696 CTGTGGGTGCAGGGGGTGGTGGG - Intronic
1133976683 16:10604109-10604131 CGATGGAGGCAGAGGTTGGAGGG + Intergenic
1133976683 16:10604109-10604131 CGATGGAGGCAGAGGTTGGAGGG + Intergenic
1134461195 16:14430708-14430730 CTCAGGAAGCTGAGGTTGGAAGG + Intergenic
1134461195 16:14430708-14430730 CTCAGGAAGCTGAGGTTGGAAGG + Intergenic
1135379705 16:21985220-21985242 CTTTGGAAGCAGAGGCCAGAGGG - Intronic
1135379705 16:21985220-21985242 CTTTGGAAGCAGAGGCCAGAGGG - Intronic
1135434933 16:22420526-22420548 CTGTGGATGCAGGAGATGGACGG - Intronic
1135434933 16:22420526-22420548 CTGTGGATGCAGGAGATGGACGG - Intronic
1135737140 16:24940758-24940780 ATGTGGCTGGAGAGGGTGGAAGG + Intronic
1135737140 16:24940758-24940780 ATGTGGCTGGAGAGGGTGGAAGG + Intronic
1135971515 16:27075289-27075311 CTGTGGAAGCAGAAACTGCAAGG - Intergenic
1135971515 16:27075289-27075311 CTGTGGAAGCAGAAACTGCAAGG - Intergenic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136512035 16:30744012-30744034 CTGTGACAGCAGTGGTTGGAAGG + Intronic
1136512035 16:30744012-30744034 CTGTGACAGCAGTGGTTGGAAGG + Intronic
1136558492 16:31024003-31024025 CTGGGGAGGCAGAGGCTGTAGGG - Intergenic
1136558492 16:31024003-31024025 CTGGGGAGGCAGAGGCTGTAGGG - Intergenic
1136571957 16:31103641-31103663 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1136571957 16:31103641-31103663 CCGTGGAAGGAGACCGTGGAGGG - Intergenic
1137727547 16:50667287-50667309 CTGAGGATGCCGAGGGTGGTGGG + Intronic
1137727547 16:50667287-50667309 CTGAGGATGCCGAGGGTGGTGGG + Intronic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1139471249 16:67179261-67179283 CTCTGTAAGCAGAGGGCGGGAGG + Intronic
1139471249 16:67179261-67179283 CTCTGTAAGCAGAGGGCGGGAGG + Intronic
1139550870 16:67672347-67672369 CTGTGGAACCACAGGTTGGGAGG + Intergenic
1139550870 16:67672347-67672369 CTGTGGAACCACAGGTTGGGAGG + Intergenic
1139686177 16:68605425-68605447 CAGAGGAAGTAGAGTGTGGAAGG - Intergenic
1139686177 16:68605425-68605447 CAGAGGAAGTAGAGTGTGGAAGG - Intergenic
1140383363 16:74511010-74511032 CCATGGAAGCAAGGGGTGGAGGG + Intronic
1140383363 16:74511010-74511032 CCATGGAAGCAAGGGGTGGAGGG + Intronic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141150311 16:81560070-81560092 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
1141150311 16:81560070-81560092 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141263572 16:82475571-82475593 CTGAGGATGCAGAGGCTGGCAGG - Intergenic
1141263572 16:82475571-82475593 CTGAGGATGCAGAGGCTGGCAGG - Intergenic
1142044116 16:87914302-87914324 CTGTGGATGCAGGAGATGGACGG - Intronic
1142044116 16:87914302-87914324 CTGTGGATGCAGGAGATGGACGG - Intronic
1142174013 16:88636713-88636735 GTATGCAAGCAGAGGGTGGGTGG + Intergenic
1142174013 16:88636713-88636735 GTATGCAAGCAGAGGGTGGGTGG + Intergenic
1142521382 17:507286-507308 TTCTGCAAGCAGAGGGTGAAAGG + Intergenic
1142521382 17:507286-507308 TTCTGCAAGCAGAGGGTGAAAGG + Intergenic
1142724893 17:1805734-1805756 CTCAGGAAGCAGAGGTTGCAGGG + Intronic
1142724893 17:1805734-1805756 CTCAGGAAGCAGAGGTTGCAGGG + Intronic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1142818393 17:2446620-2446642 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1142818393 17:2446620-2446642 CCGTGGAAGGAGACCGTGGAGGG - Intronic
1143065588 17:4244688-4244710 CTGAGGAAGCAAAGGGGAGATGG - Intronic
1143065588 17:4244688-4244710 CTGAGGAAGCAAAGGGGAGATGG - Intronic
1143410099 17:6703488-6703510 CTATGGGAGCAGAGAGTGGAAGG + Intronic
1143410099 17:6703488-6703510 CTATGGGAGCAGAGAGTGGAAGG + Intronic
1144343056 17:14326393-14326415 CTGTGGAAGCAAGGGATGGAGGG + Intronic
1144343056 17:14326393-14326415 CTGTGGAAGCAAGGGATGGAGGG + Intronic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145108247 17:20138288-20138310 GTGTGGGGGCAGAGGGTGTATGG - Intronic
1145108247 17:20138288-20138310 GTGTGGGGGCAGAGGGTGTATGG - Intronic
1145209531 17:21003074-21003096 CTGTGGAGGCAGAGAGAGGGAGG + Intronic
1145209531 17:21003074-21003096 CTGTGGAGGCAGAGAGAGGGAGG + Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147178554 17:38671519-38671541 CTCCCGAAGCACAGGGTGGAAGG + Intergenic
1147178554 17:38671519-38671541 CTCCCGAAGCACAGGGTGGAAGG + Intergenic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1147464319 17:40599040-40599062 AGGAGGAAGGAGAGGGTGGAAGG - Intergenic
1147464319 17:40599040-40599062 AGGAGGAAGGAGAGGGTGGAAGG - Intergenic
1147836753 17:43338319-43338341 CTGTGGAGGGATAGGGTTGAGGG + Intergenic
1147836753 17:43338319-43338341 CTGTGGAGGGATAGGGTTGAGGG + Intergenic
1148376229 17:47149001-47149023 CTCGGGAAGCAGAGGTTGCAGGG + Intronic
1148376229 17:47149001-47149023 CTCGGGAAGCAGAGGTTGCAGGG + Intronic
1148412271 17:47477859-47477881 CTGTGTCATCAGTGGGTGGAAGG + Intergenic
1148412271 17:47477859-47477881 CTGTGTCATCAGTGGGTGGAAGG + Intergenic
1148485529 17:47988356-47988378 CTGTGGAGGCTGAGGTGGGAGGG + Intergenic
1148485529 17:47988356-47988378 CTGTGGAGGCTGAGGTGGGAGGG + Intergenic
1148603002 17:48908382-48908404 CTGTGGAAGCGGAGGGGGTGGGG + Exonic
1148603002 17:48908382-48908404 CTGTGGAAGCGGAGGGGGTGGGG + Exonic
1148695742 17:49556945-49556967 GTGTGGGAGCAGAGGGTGCTGGG - Intergenic
1148695742 17:49556945-49556967 GTGTGGGAGCAGAGGGTGCTGGG - Intergenic
1148758170 17:49985505-49985527 CTGTGGAGGCAGAGCCTGCATGG - Intergenic
1148758170 17:49985505-49985527 CTGTGGAGGCAGAGCCTGCATGG - Intergenic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1149621906 17:58051697-58051719 CTGGGGAACCAGTGTGTGGAAGG - Intergenic
1149621906 17:58051697-58051719 CTGGGGAACCAGTGTGTGGAAGG - Intergenic
1150198070 17:63321912-63321934 CTGTGGAAGAGAAGGGTGAAGGG - Intronic
1150198070 17:63321912-63321934 CTGTGGAAGAGAAGGGTGAAGGG - Intronic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151892453 17:76958669-76958691 CTCTGAAGGCAGAGGGTGGGTGG + Intergenic
1151892453 17:76958669-76958691 CTCTGAAGGCAGAGGGTGGGTGG + Intergenic
1152231419 17:79115749-79115771 CTGTGGAAGGAGAGAGAGCAAGG + Intronic
1152231419 17:79115749-79115771 CTGTGGAAGGAGAGAGAGCAAGG + Intronic
1152287723 17:79422355-79422377 CTGTGGCAGCACAGGACGGAGGG - Intronic
1152287723 17:79422355-79422377 CTGTGGCAGCACAGGACGGAGGG - Intronic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1152825758 17:82463715-82463737 GTCAGGAAGGAGAGGGTGGAGGG + Intronic
1152825758 17:82463715-82463737 GTCAGGAAGGAGAGGGTGGAGGG + Intronic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153586487 18:6626059-6626081 CTCTGGATGGAGATGGTGGATGG + Intergenic
1153586487 18:6626059-6626081 CTCTGGATGGAGATGGTGGATGG + Intergenic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1154393824 18:13968960-13968982 CTGTGGCATCACATGGTGGAAGG + Intergenic
1154393824 18:13968960-13968982 CTGTGGCATCACATGGTGGAAGG + Intergenic
1155107782 18:22684709-22684731 CCGTGGAGGCAGAGGTTGCAGGG + Intergenic
1155107782 18:22684709-22684731 CCGTGGAGGCAGAGGTTGCAGGG + Intergenic
1155210734 18:23598472-23598494 TTGTGGCGGCAGAGGGTGGATGG + Intergenic
1155210734 18:23598472-23598494 TTGTGGCGGCAGAGGGTGGATGG + Intergenic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155449020 18:25944019-25944041 TTCTGCAAGCACAGGGTGGATGG - Intergenic
1155449020 18:25944019-25944041 TTCTGCAAGCACAGGGTGGATGG - Intergenic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157378558 18:47189838-47189860 CTGTGAAGGCAGAGGGTTGAGGG + Intergenic
1157378558 18:47189838-47189860 CTGTGAAGGCAGAGGGTTGAGGG + Intergenic
1157393900 18:47326014-47326036 CTGTGGAAGCCCAGGAGGGAAGG + Intergenic
1157393900 18:47326014-47326036 CTGTGGAAGCCCAGGAGGGAAGG + Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157640840 18:49212738-49212760 CTTTGGAAGGCCAGGGTGGATGG - Intronic
1157640840 18:49212738-49212760 CTTTGGAAGGCCAGGGTGGATGG - Intronic
1157714823 18:49876847-49876869 ATGCTGGAGCAGAGGGTGGAGGG - Intronic
1157714823 18:49876847-49876869 ATGCTGGAGCAGAGGGTGGAGGG - Intronic
1157748483 18:50158029-50158051 GGGTGGAAGCAGAGGATGGCAGG + Intronic
1157748483 18:50158029-50158051 GGGTGGAAGCAGAGGATGGCAGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158283082 18:55849151-55849173 CTGTGAAAGCAGAGGTTTGTGGG - Intergenic
1158283082 18:55849151-55849173 CTGTGAAAGCAGAGGTTTGTGGG - Intergenic
1158626891 18:59079373-59079395 CTGAGCAAGCACAGGGTGGCTGG - Intergenic
1158626891 18:59079373-59079395 CTGAGCAAGCACAGGGTGGCTGG - Intergenic
1160041973 18:75353597-75353619 CTGTGGAAGGACAGTGTGTAAGG + Intergenic
1160041973 18:75353597-75353619 CTGTGGAAGGACAGTGTGTAAGG + Intergenic
1160121046 18:76130754-76130776 CGATGGAGGCAGAGCGTGGAGGG + Intergenic
1160121046 18:76130754-76130776 CGATGGAGGCAGAGCGTGGAGGG + Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160424958 18:78773325-78773347 CTGTGGGAGCTGAGTGTGCAGGG - Intergenic
1160424958 18:78773325-78773347 CTGTGGGAGCTGAGTGTGCAGGG - Intergenic
1160479053 18:79221334-79221356 CTGTGGAAGCAGATGGCTGCAGG - Intronic
1160479053 18:79221334-79221356 CTGTGGAAGCAGATGGCTGCAGG - Intronic
1160839837 19:1141288-1141310 CTCGGGAAGCAGAGGTTGCAGGG - Intronic
1160839837 19:1141288-1141310 CTCGGGAAGCAGAGGTTGCAGGG - Intronic
1161639990 19:5416181-5416203 CTGTGGAAAAAGAGTGTGGCAGG - Intergenic
1161639990 19:5416181-5416203 CTGTGGAAAAAGAGTGTGGCAGG - Intergenic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162429489 19:10619077-10619099 CTGGGGAAGCCTAGGGTGGGAGG - Intronic
1162429489 19:10619077-10619099 CTGGGGAAGCCTAGGGTGGGAGG - Intronic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1162732638 19:12728184-12728206 CTCAGCAAGTAGAGGGTGGAAGG - Intergenic
1162732638 19:12728184-12728206 CTCAGCAAGTAGAGGGTGGAAGG - Intergenic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1163440376 19:17319759-17319781 GTGTGGACGCAGGGTGTGGATGG - Exonic
1163440376 19:17319759-17319781 GTGTGGACGCAGGGTGTGGATGG - Exonic
1163764644 19:19156032-19156054 ATGTAGACGCAGAGGCTGGATGG + Intronic
1163764644 19:19156032-19156054 ATGTAGACGCAGAGGCTGGATGG + Intronic
1164464359 19:28475043-28475065 CTGAGGGAGCAGGGGGTGGGCGG - Intergenic
1164464359 19:28475043-28475065 CTGAGGGAGCAGGGGGTGGGCGG - Intergenic
1164514344 19:28921442-28921464 CTGTGGAGTGAGAGGCTGGAGGG + Intergenic
1164514344 19:28921442-28921464 CTGTGGAGTGAGAGGCTGGAGGG + Intergenic
1165407046 19:35637419-35637441 CTGTGGAGACAGAGGGTTCAAGG - Intronic
1165407046 19:35637419-35637441 CTGTGGAGACAGAGGGTTCAAGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165789373 19:38482377-38482399 TTGTGGAGGCAGAGGCTGGCTGG + Intronic
1165789373 19:38482377-38482399 TTGTGGAGGCAGAGGCTGGCTGG + Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166881675 19:45933992-45934014 CTCTGGTCGCAGAGGATGGAAGG + Exonic
1166881675 19:45933992-45934014 CTCTGGTCGCAGAGGATGGAAGG + Exonic
1166930760 19:46299802-46299824 GTGAGGAAGCAGACGGTGGGGGG + Intronic
1166930760 19:46299802-46299824 GTGAGGAAGCAGACGGTGGGGGG + Intronic
1167146103 19:47681375-47681397 CTGTGGCAGCTGGGGGGGGAAGG + Intronic
1167146103 19:47681375-47681397 CTGTGGCAGCTGGGGGGGGAAGG + Intronic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167642119 19:50687709-50687731 CTGTGGTGGTAGAGGGTGGTGGG - Intronic
1167642119 19:50687709-50687731 CTGTGGTGGTAGAGGGTGGTGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925119858 2:1409898-1409920 TCATGGAAGCAGAGAGTGGATGG + Intronic
925119858 2:1409898-1409920 TCATGGAAGCAGAGAGTGGATGG + Intronic
925319598 2:2951991-2952013 CTGTGGAATCAGAGGAGGGTGGG - Intergenic
925319598 2:2951991-2952013 CTGTGGAATCAGAGGAGGGTGGG - Intergenic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
925632454 2:5908793-5908815 CTCAGGGAGAAGAGGGTGGAGGG + Intergenic
925632454 2:5908793-5908815 CTCAGGGAGAAGAGGGTGGAGGG + Intergenic
925842985 2:8009660-8009682 TTGTGGAATCAGATGTTGGATGG + Intergenic
925842985 2:8009660-8009682 TTGTGGAATCAGATGTTGGATGG + Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926206936 2:10840473-10840495 CTGTGGAAGGAGACTGTAGATGG + Intergenic
926206936 2:10840473-10840495 CTGTGGAAGGAGACTGTAGATGG + Intergenic
926365509 2:12129615-12129637 CTGTGGAAATAAAGGGTTGAAGG - Intergenic
926365509 2:12129615-12129637 CTGTGGAAATAAAGGGTTGAAGG - Intergenic
926853656 2:17228563-17228585 CTGTGGAAGCAGCTGCTGGTTGG - Intergenic
926853656 2:17228563-17228585 CTGTGGAAGCAGCTGCTGGTTGG - Intergenic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
927850819 2:26498234-26498256 CAGTAGAGGCGGAGGGTGGAGGG + Intronic
927850819 2:26498234-26498256 CAGTAGAGGCGGAGGGTGGAGGG + Intronic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
928395937 2:30943373-30943395 CAGTGGATCCAGAGGGTGAAGGG + Intronic
928395937 2:30943373-30943395 CAGTGGATCCAGAGGGTGAAGGG + Intronic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932129555 2:69175514-69175536 CTGGGGAGGCTGAGGCTGGAGGG + Intronic
932129555 2:69175514-69175536 CTGGGGAGGCTGAGGCTGGAGGG + Intronic
932134104 2:69213652-69213674 CTGTGGAAGCACAGCTTGGTGGG + Intronic
932134104 2:69213652-69213674 CTGTGGAAGCACAGCTTGGTGGG + Intronic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
933174319 2:79158773-79158795 AGGTGGAAGAAGAGGGGGGAGGG + Intronic
933174319 2:79158773-79158795 AGGTGGAAGAAGAGGGGGGAGGG + Intronic
933877039 2:86630231-86630253 CTTTAGAAGCCCAGGGTGGAGGG - Intronic
933877039 2:86630231-86630253 CTTTAGAAGCCCAGGGTGGAGGG - Intronic
934053530 2:88231711-88231733 CAGTGGAGGCAGAGGCTGGTGGG + Intergenic
934053530 2:88231711-88231733 CAGTGGAGGCAGAGGCTGGTGGG + Intergenic
934676606 2:96253813-96253835 GTGTGTAAGCAGGGGGTGGCTGG + Exonic
934676606 2:96253813-96253835 GTGTGTAAGCAGGGGGTGGCTGG + Exonic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935828741 2:106977195-106977217 CTGTGGCATCAGAGTGTGGATGG + Intergenic
935828741 2:106977195-106977217 CTGTGGCATCAGAGTGTGGATGG + Intergenic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
938124947 2:128664693-128664715 CTGGGGTAGCAGTGGGAGGAGGG + Intergenic
938124947 2:128664693-128664715 CTGGGGTAGCAGTGGGAGGAGGG + Intergenic
938261104 2:129895645-129895667 CTGTGGAAGGAGAGATTGGTGGG + Intergenic
938261104 2:129895645-129895667 CTGTGGAAGGAGAGATTGGTGGG + Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939308351 2:140438122-140438144 CTCTGGAGGCTGAGGCTGGAGGG - Intronic
939308351 2:140438122-140438144 CTCTGGAGGCTGAGGCTGGAGGG - Intronic
940961403 2:159790496-159790518 CTCTGGCAGCAGAGAGGGGAAGG - Intronic
940961403 2:159790496-159790518 CTCTGGCAGCAGAGAGGGGAAGG - Intronic
941011782 2:160308285-160308307 CTCAGGAAGCTGAGGGTGGAAGG + Intronic
941011782 2:160308285-160308307 CTCAGGAAGCTGAGGGTGGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942168412 2:173265227-173265249 CTGAGGAAGCTGAGGCTGGGAGG + Intronic
942168412 2:173265227-173265249 CTGAGGAAGCTGAGGCTGGGAGG + Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
945289035 2:208109841-208109863 CTTTGGAAGGCCAGGGTGGAAGG + Intergenic
945289035 2:208109841-208109863 CTTTGGAAGGCCAGGGTGGAAGG + Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946022495 2:216650642-216650664 CTGTGGTAGCTGCAGGTGGAGGG + Intronic
946022495 2:216650642-216650664 CTGTGGTAGCTGCAGGTGGAGGG + Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946281384 2:218668202-218668224 GTGTGGCAGCAAAGGGAGGAAGG - Intronic
946281384 2:218668202-218668224 GTGTGGCAGCAAAGGGAGGAAGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947576481 2:231279017-231279039 CTGTGGCAACAGAGAGTGGATGG - Intronic
947576481 2:231279017-231279039 CTGTGGCAACAGAGAGTGGATGG - Intronic
947587031 2:231362629-231362651 GTGAGGAAGAAGAGGATGGAAGG + Intronic
947587031 2:231362629-231362651 GTGAGGAAGAAGAGGATGGAAGG + Intronic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948695721 2:239732192-239732214 TGGAGGAAGGAGAGGGTGGAGGG - Intergenic
948695721 2:239732192-239732214 TGGAGGAAGGAGAGGGTGGAGGG - Intergenic
1168748411 20:264466-264488 CAGTTGAAGCTGAGGGTAGAGGG - Intergenic
1168748411 20:264466-264488 CAGTTGAAGCTGAGGGTAGAGGG - Intergenic
1169279571 20:4255490-4255512 CTATGTCAGCAGAGGCTGGAGGG + Intergenic
1169279571 20:4255490-4255512 CTATGTCAGCAGAGGCTGGAGGG + Intergenic
1169337831 20:4771667-4771689 GTGTGGAAGCAGAGGATAGCTGG + Intergenic
1169337831 20:4771667-4771689 GTGTGGAAGCAGAGGATAGCTGG + Intergenic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1170155261 20:13263336-13263358 GAGTGGAAGCAGGGGGTGGTGGG - Intronic
1170155261 20:13263336-13263358 GAGTGGAAGCAGGGGGTGGTGGG - Intronic
1170458135 20:16552552-16552574 CTGTGGAAGCCCATGGTGGGGGG - Intronic
1170458135 20:16552552-16552574 CTGTGGAAGCCCATGGTGGGGGG - Intronic
1170544546 20:17424405-17424427 CTGAGGAAGCAAAGAGGGGAAGG + Intronic
1170544546 20:17424405-17424427 CTGAGGAAGCAAAGAGGGGAAGG + Intronic
1170723670 20:18906164-18906186 CTGTGGATGCAGAGGGTGAGAGG + Intergenic
1170723670 20:18906164-18906186 CTGTGGATGCAGAGGGTGAGAGG + Intergenic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1172212011 20:33206686-33206708 CTCTGGAGGCAGAGGTTGCAGGG - Intergenic
1172212011 20:33206686-33206708 CTCTGGAGGCAGAGGTTGCAGGG - Intergenic
1172463547 20:35137938-35137960 GGGTGGAAGTAGAGGCTGGATGG - Exonic
1172463547 20:35137938-35137960 GGGTGGAAGTAGAGGCTGGATGG - Exonic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173632665 20:44528339-44528361 CTGGGGAGGCAGAGGCTGCAGGG + Intergenic
1173632665 20:44528339-44528361 CTGGGGAGGCAGAGGCTGCAGGG + Intergenic
1174047091 20:47741262-47741284 CTGTGGCTGCAGAGAGTGGGCGG - Intronic
1174047091 20:47741262-47741284 CTGTGGCTGCAGAGAGTGGGCGG - Intronic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175296671 20:57913452-57913474 CTGTGGGAGCACAGGTTGTACGG + Intergenic
1175296671 20:57913452-57913474 CTGTGGGAGCACAGGTTGTACGG + Intergenic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175642920 20:60646403-60646425 CTGTGGACAGAGAGGGTGGCTGG + Intergenic
1175642920 20:60646403-60646425 CTGTGGACAGAGAGGGTGGCTGG + Intergenic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175885541 20:62288384-62288406 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885541 20:62288384-62288406 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885547 20:62288407-62288429 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885547 20:62288407-62288429 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885565 20:62288475-62288497 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885565 20:62288475-62288497 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885577 20:62288520-62288542 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885577 20:62288520-62288542 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885589 20:62288565-62288587 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885589 20:62288565-62288587 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1175992821 20:62797853-62797875 CTGTGGCAGCAGGAGGTGGTGGG + Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177067337 21:16456314-16456336 CTGTGGAGGTTGAGGGTGGGAGG - Intergenic
1177067337 21:16456314-16456336 CTGTGGAGGTTGAGGGTGGGAGG - Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1178151940 21:29805140-29805162 CTGTGGCTGCAGGGGGTGGAGGG - Intronic
1178151940 21:29805140-29805162 CTGTGGCTGCAGGGGGTGGAGGG - Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1180199634 21:46216474-46216496 CAGTGGCACCAGAGTGTGGAGGG + Exonic
1180199634 21:46216474-46216496 CAGTGGCACCAGAGTGTGGAGGG + Exonic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181863015 22:25834009-25834031 GTGAGGAAGCACAGTGTGGAAGG - Intronic
1181863015 22:25834009-25834031 GTGAGGAAGCACAGTGTGGAAGG - Intronic
1182557357 22:31136527-31136549 CTGGGGCAGCAGGGGGTAGAGGG + Intronic
1182557357 22:31136527-31136549 CTGGGGCAGCAGGGGGTAGAGGG + Intronic
1182742087 22:32575248-32575270 TTGAGGAAGCATTGGGTGGAAGG + Intronic
1182742087 22:32575248-32575270 TTGAGGAAGCATTGGGTGGAAGG + Intronic
1183038961 22:35161866-35161888 CTGTGGGAGTAGAAGGTGTAGGG - Intergenic
1183038961 22:35161866-35161888 CTGTGGGAGTAGAAGGTGTAGGG - Intergenic
1184332975 22:43837623-43837645 CAGTGGAAGCAGAGGCTCAAGGG + Intronic
1184332975 22:43837623-43837645 CAGTGGAAGCAGAGGCTCAAGGG + Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1184914453 22:47559481-47559503 GTGAGGAAGCAGAGGAGGGAAGG + Intergenic
1184914453 22:47559481-47559503 GTGAGGAAGCAGAGGAGGGAAGG + Intergenic
1184946658 22:47808704-47808726 CGGTGGAAGCAATGTGTGGAGGG - Intergenic
1184946658 22:47808704-47808726 CGGTGGAAGCAATGTGTGGAGGG - Intergenic
1185196783 22:49476726-49476748 CTTTGCAACCAGTGGGTGGATGG + Intronic
1185196783 22:49476726-49476748 CTTTGCAACCAGTGGGTGGATGG + Intronic
1185291056 22:50028000-50028022 CTTTGGAAGCAGCTGGTGGGTGG + Intronic
1185291056 22:50028000-50028022 CTTTGGAAGCAGCTGGTGGGTGG + Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949359104 3:3213043-3213065 CTCAGGAAGCCGAGGGTGGGAGG - Intergenic
949359104 3:3213043-3213065 CTCAGGAAGCCGAGGGTGGGAGG - Intergenic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949891727 3:8738266-8738288 CTGTGGCAGATGTGGGTGGAGGG - Intronic
949891727 3:8738266-8738288 CTGTGGCAGATGTGGGTGGAGGG - Intronic
949942192 3:9163575-9163597 CTGTCAAAGCAGAGGGGGCAGGG + Intronic
949942192 3:9163575-9163597 CTGTCAAAGCAGAGGGGGCAGGG + Intronic
950139258 3:10604040-10604062 GTATGGAGGCAGAGGGAGGAGGG - Intronic
950139258 3:10604040-10604062 GTATGGAGGCAGAGGGAGGAGGG - Intronic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951097513 3:18649134-18649156 CTCTGGAGGCAGAGGTTGCAGGG + Intergenic
951097513 3:18649134-18649156 CTCTGGAGGCAGAGGTTGCAGGG + Intergenic
952409540 3:33034703-33034725 CTGAGGAAGCAGTTGGTTGATGG + Intronic
952409540 3:33034703-33034725 CTGAGGAAGCAGTTGGTTGATGG + Intronic
952529079 3:34244545-34244567 CTGTGGAAGGCGAGGGTTGTGGG - Intergenic
952529079 3:34244545-34244567 CTGTGGAAGGCGAGGGTTGTGGG - Intergenic
952769353 3:36983778-36983800 TTATGGGAGCAGAGGGTGAAGGG - Intergenic
952769353 3:36983778-36983800 TTATGGGAGCAGAGGGTGAAGGG - Intergenic
952841976 3:37654259-37654281 CTGTGGCAGGAGAGGGCTGAAGG + Intronic
952841976 3:37654259-37654281 CTGTGGCAGGAGAGGGCTGAAGG + Intronic
953137535 3:40195398-40195420 CTTGGGAAGCTGAGGCTGGAGGG - Intronic
953137535 3:40195398-40195420 CTTGGGAAGCTGAGGCTGGAGGG - Intronic
953530689 3:43737204-43737226 CTGTGGAAGCAGGGTGTGGCTGG + Intergenic
953530689 3:43737204-43737226 CTGTGGAAGCAGGGTGTGGCTGG + Intergenic
954500220 3:51006592-51006614 CTGTGGAAGCAGAGCTTGAAGGG - Intronic
954500220 3:51006592-51006614 CTGTGGAAGCAGAGCTTGAAGGG - Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
954570668 3:51638261-51638283 CTGTGGTAGCAGCGGTTGGCTGG + Exonic
954570668 3:51638261-51638283 CTGTGGTAGCAGCGGTTGGCTGG + Exonic
954575170 3:51671772-51671794 CGGTGCTAGCAGAGGGCGGAAGG - Exonic
954575170 3:51671772-51671794 CGGTGCTAGCAGAGGGCGGAAGG - Exonic
954638693 3:52085380-52085402 GTGAGGAGGCAGAGGGTGAAGGG - Intronic
954638693 3:52085380-52085402 GTGAGGAGGCAGAGGGTGAAGGG - Intronic
954758494 3:52856574-52856596 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
954758494 3:52856574-52856596 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
955472775 3:59303257-59303279 ATGGGGAAGCAGAGGCTAGAAGG - Intergenic
955472775 3:59303257-59303279 ATGGGGAAGCAGAGGCTAGAAGG - Intergenic
956484040 3:69702706-69702728 CTCCTGGAGCAGAGGGTGGAGGG - Intergenic
956484040 3:69702706-69702728 CTCCTGGAGCAGAGGGTGGAGGG - Intergenic
957211375 3:77262825-77262847 CTGAGACAGCAGAGGTTGGATGG + Intronic
957211375 3:77262825-77262847 CTGAGACAGCAGAGGTTGGATGG + Intronic
958410931 3:93814922-93814944 CTAGGGAAGCAGAGGCTGAAAGG + Intergenic
958410931 3:93814922-93814944 CTAGGGAAGCAGAGGCTGAAAGG + Intergenic
960108722 3:113824862-113824884 CTGTGTAAGCAAAGGGTGACTGG + Intergenic
960108722 3:113824862-113824884 CTGTGTAAGCAAAGGGTGACTGG + Intergenic
960941097 3:122935314-122935336 CTGGGGGAGCAGGGGGTGGGAGG + Intronic
960941097 3:122935314-122935336 CTGGGGGAGCAGGGGGTGGGAGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962655689 3:137542238-137542260 CTGTGGCAGCACAGGGTGCAGGG + Intergenic
962655689 3:137542238-137542260 CTGTGGCAGCACAGGGTGCAGGG + Intergenic
962942151 3:140134747-140134769 TGGGGGAAGGAGAGGGTGGAGGG + Intronic
962942151 3:140134747-140134769 TGGGGGAAGGAGAGGGTGGAGGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963068474 3:141282404-141282426 CTGTGGGAGACCAGGGTGGAAGG - Intronic
963068474 3:141282404-141282426 CTGTGGGAGACCAGGGTGGAAGG - Intronic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963716254 3:148807680-148807702 CGGAGGAGGCAGAGGCTGGAAGG + Intronic
963716254 3:148807680-148807702 CGGAGGAGGCAGAGGCTGGAAGG + Intronic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964689803 3:159437587-159437609 CGGAGGAAGGAGACGGTGGAGGG + Intronic
964689803 3:159437587-159437609 CGGAGGAAGGAGACGGTGGAGGG + Intronic
965511538 3:169573138-169573160 CTGTGAAAGCAGAGGGTGAGGGG - Intronic
965511538 3:169573138-169573160 CTGTGAAAGCAGAGGGTGAGGGG - Intronic
965695273 3:171401494-171401516 CTGAGGAAGGAGAGGGTTCAGGG + Intronic
965695273 3:171401494-171401516 CTGAGGAAGGAGAGGGTTCAGGG + Intronic
966683808 3:182671949-182671971 CTGAGGAGGCAGAGGAGGGAAGG - Intergenic
966683808 3:182671949-182671971 CTGAGGAGGCAGAGGAGGGAAGG - Intergenic
967327615 3:188257913-188257935 CTGTAGCAGCACTGGGTGGAAGG - Intronic
967327615 3:188257913-188257935 CTGTAGCAGCACTGGGTGGAAGG - Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967579003 3:191129815-191129837 CGGTTGATGCAAAGGGTGGAAGG - Intergenic
967579003 3:191129815-191129837 CGGTTGATGCAAAGGGTGGAAGG - Intergenic
968006571 3:195247244-195247266 CTGTGAAATCTGAGGGTGGTCGG + Intronic
968006571 3:195247244-195247266 CTGTGAAATCTGAGGGTGGTCGG + Intronic
968076853 3:195820693-195820715 CGATGGAGGCAGAGGCTGGAGGG - Intergenic
968076853 3:195820693-195820715 CGATGGAGGCAGAGGCTGGAGGG - Intergenic
968426309 4:525838-525860 GTGAGGAAGCGGAGGGGGGACGG + Intronic
968426309 4:525838-525860 GTGAGGAAGCGGAGGGGGGACGG + Intronic
968506987 4:975353-975375 CCGTGGAAGGAGACCGTGGAGGG - Intronic
968506987 4:975353-975375 CCGTGGAAGGAGACCGTGGAGGG - Intronic
968540260 4:1164702-1164724 CTGTGGCAGCACAGTGTGCAGGG + Intergenic
968540260 4:1164702-1164724 CTGTGGCAGCACAGTGTGCAGGG + Intergenic
969180092 4:5433668-5433690 CTGTGGAAACAGATCCTGGAAGG + Intronic
969180092 4:5433668-5433690 CTGTGGAAACAGATCCTGGAAGG + Intronic
969393556 4:6906794-6906816 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
969393556 4:6906794-6906816 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
969696326 4:8737193-8737215 CTGGGGACGCAGAGGCTGTAAGG + Intergenic
969696326 4:8737193-8737215 CTGGGGACGCAGAGGCTGTAAGG + Intergenic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
971356842 4:25902825-25902847 CTCTGGAAGCTGAGGTGGGAGGG - Intronic
971356842 4:25902825-25902847 CTCTGGAAGCTGAGGTGGGAGGG - Intronic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
972933607 4:44104624-44104646 CAGTGGAAGGAGAGTGTGGGTGG + Intergenic
972933607 4:44104624-44104646 CAGTGGAAGGAGAGTGTGGGTGG + Intergenic
973299307 4:48561906-48561928 CTCAGGAGGCTGAGGGTGGAGGG + Intronic
973299307 4:48561906-48561928 CTCAGGAGGCTGAGGGTGGAGGG + Intronic
973760386 4:54109671-54109693 GGGTGGACGCAGAGGGAGGAAGG + Intronic
973760386 4:54109671-54109693 GGGTGGACGCAGAGGGAGGAAGG + Intronic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
975378337 4:73670561-73670583 CTGTGGAGGGATAGGGTTGAGGG + Intergenic
975378337 4:73670561-73670583 CTGTGGAGGGATAGGGTTGAGGG + Intergenic
975685414 4:76916090-76916112 CCGTGGAAGGAGACTGTGGAGGG - Intergenic
975685414 4:76916090-76916112 CCGTGGAAGGAGACTGTGGAGGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978237407 4:106475542-106475564 CTATGGGAGAAGAGTGTGGAAGG + Intergenic
978237407 4:106475542-106475564 CTATGGGAGAAGAGTGTGGAAGG + Intergenic
978339070 4:107702544-107702566 CTGTAGAAGTAGAGAGTGAATGG - Intronic
978339070 4:107702544-107702566 CTGTAGAAGTAGAGAGTGAATGG - Intronic
978482899 4:109214715-109214737 TTCTGGAAGCACAGGGTAGATGG - Intronic
978482899 4:109214715-109214737 TTCTGGAAGCACAGGGTAGATGG - Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
979996304 4:127435548-127435570 CTGGGGAAGCAGAGGTTGGGAGG + Intergenic
979996304 4:127435548-127435570 CTGGGGAAGCAGAGGTTGGGAGG + Intergenic
980246212 4:130246089-130246111 TTGTGCAAGCTCAGGGTGGAGGG + Intergenic
980246212 4:130246089-130246111 TTGTGCAAGCTCAGGGTGGAGGG + Intergenic
981419766 4:144535878-144535900 CTCAGGAAGGAGAGGCTGGATGG - Intergenic
981419766 4:144535878-144535900 CTCAGGAAGGAGAGGCTGGATGG - Intergenic
982217125 4:153092075-153092097 CCGTGGAGGCAGAGACTGGAGGG - Intergenic
982217125 4:153092075-153092097 CCGTGGAGGCAGAGACTGGAGGG - Intergenic
982430499 4:155316394-155316416 CAGTGGAAAGACAGGGTGGAAGG + Intergenic
982430499 4:155316394-155316416 CAGTGGAAAGACAGGGTGGAAGG + Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984833763 4:184000159-184000181 CAGTAGAAGCAGAGGCTGGGAGG - Intronic
984833763 4:184000159-184000181 CAGTAGAAGCAGAGGCTGGGAGG - Intronic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985475334 5:75616-75638 CTGTGAAAACACCGGGTGGATGG + Intergenic
985475334 5:75616-75638 CTGTGAAAACACCGGGTGGATGG + Intergenic
985566512 5:621015-621037 ATGGGGAAGAAGAGGGTGCAGGG + Intronic
985566512 5:621015-621037 ATGGGGAAGAAGAGGGTGCAGGG + Intronic
985701520 5:1376078-1376100 GTGTGGGAGAAGGGGGTGGAAGG - Intergenic
985701520 5:1376078-1376100 GTGTGGGAGAAGGGGGTGGAAGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
985958397 5:3281591-3281613 CCGTGGAAGCAGCGAGTGCAGGG + Intergenic
985958397 5:3281591-3281613 CCGTGGAAGCAGCGAGTGCAGGG + Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986163841 5:5255568-5255590 CTCTGGAAGCAGTGGATGTAAGG - Intronic
986163841 5:5255568-5255590 CTCTGGAAGCAGTGGATGTAAGG - Intronic
986621919 5:9684959-9684981 GTGTGGTAGCAGAGGGTGTCAGG - Intronic
986621919 5:9684959-9684981 GTGTGGTAGCAGAGGGTGTCAGG - Intronic
986755411 5:10831589-10831611 CTGCAGAAGCACTGGGTGGAGGG - Intergenic
986755411 5:10831589-10831611 CTGCAGAAGCACTGGGTGGAGGG - Intergenic
986970847 5:13334731-13334753 TACTGGAAGCAGAGGGTGGGAGG - Intergenic
986970847 5:13334731-13334753 TACTGGAAGCAGAGGGTGGGAGG - Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990141348 5:52707903-52707925 CTATGGAGGCAGAGGGTGTATGG - Intergenic
990141348 5:52707903-52707925 CTATGGAGGCAGAGGGTGTATGG - Intergenic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
996525491 5:124474672-124474694 TTGTGGAAACAGAGGGGGTATGG - Intergenic
996525491 5:124474672-124474694 TTGTGGAAACAGAGGGGGTATGG - Intergenic
996790638 5:127290224-127290246 AGGTGAAGGCAGAGGGTGGAGGG - Intergenic
996790638 5:127290224-127290246 AGGTGAAGGCAGAGGGTGGAGGG - Intergenic
997056674 5:130452208-130452230 CTGTGGCTTTAGAGGGTGGAAGG - Intergenic
997056674 5:130452208-130452230 CTGTGGCTTTAGAGGGTGGAAGG - Intergenic
997593798 5:135092695-135092717 GTGAGGAAGGAGAGGGTGTATGG - Intronic
997593798 5:135092695-135092717 GTGAGGAAGGAGAGGGTGTATGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998275950 5:140753584-140753606 CAGTGGCAGCAGAGGGTTCATGG + Intergenic
998275950 5:140753584-140753606 CAGTGGCAGCAGAGGGTTCATGG + Intergenic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
998893068 5:146767637-146767659 GTGTGGAAGCAGGGAGTGTATGG - Intronic
998893068 5:146767637-146767659 GTGTGGAAGCAGGGAGTGTATGG - Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001535125 5:172492664-172492686 CTGTGGAAGGAAAGGGTGAGGGG + Intergenic
1001535125 5:172492664-172492686 CTGTGGAAGGAAAGGGTGAGGGG + Intergenic
1001818736 5:174693252-174693274 CTCTGGAAACACAGGGGGGAGGG - Intergenic
1001818736 5:174693252-174693274 CTCTGGAAACACAGGGGGGAGGG - Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002050514 5:176568098-176568120 GTGTCGGAGCAGAGGCTGGATGG + Intronic
1002050514 5:176568098-176568120 GTGTCGGAGCAGAGGCTGGATGG + Intronic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1002185056 5:177450546-177450568 CTATGGAAGGAGATGCTGGAGGG - Intronic
1002435095 5:179226518-179226540 CTGTGGGAGGCCAGGGTGGATGG - Intronic
1002435095 5:179226518-179226540 CTGTGGGAGGCCAGGGTGGATGG - Intronic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004178734 6:13363317-13363339 CTCTGTAAGCAGAGTGTGCAAGG + Exonic
1004178734 6:13363317-13363339 CTCTGTAAGCAGAGTGTGCAAGG + Exonic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1006599447 6:35215762-35215784 CTGTGAAAGGACAGGTTGGAGGG - Intronic
1006599447 6:35215762-35215784 CTGTGAAAGGACAGGTTGGAGGG - Intronic
1006630041 6:35424380-35424402 GTGTGGAAGCAGTTGGTGAATGG + Exonic
1006630041 6:35424380-35424402 GTGTGGAAGCAGTTGGTGAATGG + Exonic
1006812198 6:36827224-36827246 GTGTGGGATCAGAGGGTGTAGGG - Intronic
1006812198 6:36827224-36827246 GTGTGGGATCAGAGGGTGTAGGG - Intronic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1006947222 6:37792752-37792774 TTTTGGAGGCAGAGGGTGGTGGG + Intergenic
1006947222 6:37792752-37792774 TTTTGGAGGCAGAGGGTGGTGGG + Intergenic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007704206 6:43781173-43781195 GTCTGGAAGCTGAGGGTGGTGGG + Intronic
1007704206 6:43781173-43781195 GTCTGGAAGCTGAGGGTGGTGGG + Intronic
1008160533 6:48069519-48069541 CTGTGGAATCACAGCGAGGAAGG - Intergenic
1008160533 6:48069519-48069541 CTGTGGAATCACAGCGAGGAAGG - Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1010107561 6:72187567-72187589 CTCAGGAAGCAGAGGTTGCAGGG - Intronic
1010107561 6:72187567-72187589 CTCAGGAAGCAGAGGTTGCAGGG - Intronic
1010801532 6:80181671-80181693 TGGTGGAAGCAGAGGTTGTAAGG + Intronic
1010801532 6:80181671-80181693 TGGTGGAAGCAGAGGTTGTAAGG + Intronic
1011659738 6:89583936-89583958 CGGTGGTGGCAGATGGTGGATGG - Intronic
1011659738 6:89583936-89583958 CGGTGGTGGCAGATGGTGGATGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013957861 6:115861395-115861417 CTGTGGACTCATATGGTGGAAGG + Intergenic
1013957861 6:115861395-115861417 CTGTGGACTCATATGGTGGAAGG + Intergenic
1014789034 6:125650822-125650844 CTGTGGAAGAAAGTGGTGGAGGG + Intergenic
1014789034 6:125650822-125650844 CTGTGGAAGAAAGTGGTGGAGGG + Intergenic
1015619696 6:135118302-135118324 TGGTGAGAGCAGAGGGTGGAGGG - Intergenic
1015619696 6:135118302-135118324 TGGTGAGAGCAGAGGGTGGAGGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016519948 6:144936069-144936091 GAATGGAAGCAGAGGGTGGGAGG - Intergenic
1016519948 6:144936069-144936091 GAATGGAAGCAGAGGGTGGGAGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1018342236 6:162863105-162863127 CTGTGGATGCAGTGTGTGCAGGG - Intronic
1018342236 6:162863105-162863127 CTGTGGATGCAGTGTGTGCAGGG - Intronic
1018696944 6:166397788-166397810 CTGTGGTCCCAGAAGGTGGAGGG - Intergenic
1018696944 6:166397788-166397810 CTGTGGTCCCAGAAGGTGGAGGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1020263204 7:6543071-6543093 CTCTGAGAGCAGAGGATGGAAGG - Intronic
1020263204 7:6543071-6543093 CTCTGAGAGCAGAGGATGGAAGG - Intronic
1020333160 7:7040729-7040751 CTTAGGAAGCTGAGTGTGGAGGG - Intergenic
1020333160 7:7040729-7040751 CTTAGGAAGCTGAGTGTGGAGGG - Intergenic
1020550864 7:9602798-9602820 CTGTGGTGGCAGAAGGTGAAAGG - Intergenic
1020550864 7:9602798-9602820 CTGTGGTGGCAGAAGGTGAAAGG - Intergenic
1020888604 7:13850719-13850741 CTGTGGAATCAGAGACTGGGTGG + Intergenic
1020888604 7:13850719-13850741 CTGTGGAATCAGAGACTGGGTGG + Intergenic
1021819981 7:24487199-24487221 TGGTGGAGGCTGAGGGTGGAGGG - Intergenic
1021819981 7:24487199-24487221 TGGTGGAGGCTGAGGGTGGAGGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022933195 7:35143923-35143945 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1022933195 7:35143923-35143945 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1023965401 7:44961251-44961273 CTGAGGGAGCTGAGGGTTGAGGG + Intergenic
1023965401 7:44961251-44961273 CTGAGGGAGCTGAGGGTTGAGGG + Intergenic
1023985099 7:45089384-45089406 CTGACCAAGCAGAGGGTGCAGGG + Intergenic
1023985099 7:45089384-45089406 CTGACCAAGCAGAGGGTGCAGGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024710081 7:52005738-52005760 CTGTGGAAGCAGAGAGGGTCTGG + Intergenic
1024710081 7:52005738-52005760 CTGTGGAAGCAGAGAGGGTCTGG + Intergenic
1025014293 7:55426600-55426622 CTGTGGAAGCAAAGAGGGCAGGG + Intronic
1025014293 7:55426600-55426622 CTGTGGAAGCAAAGAGGGCAGGG + Intronic
1026068080 7:67093057-67093079 CTGAGGAGGCAGAGGTGGGAGGG + Intronic
1026068080 7:67093057-67093079 CTGAGGAGGCAGAGGTGGGAGGG + Intronic
1026501840 7:70949200-70949222 CATTGCAAGCAGGGGGTGGAGGG - Intergenic
1026501840 7:70949200-70949222 CATTGCAAGCAGGGGGTGGAGGG - Intergenic
1026708844 7:72719253-72719275 CTGAGGAGGCAGAGGCGGGAGGG - Intronic
1026708844 7:72719253-72719275 CTGAGGAGGCAGAGGCGGGAGGG - Intronic
1026728992 7:72894933-72894955 ATGTGGAAGCTGAGGTGGGAGGG - Intronic
1026728992 7:72894933-72894955 ATGTGGAAGCTGAGGTGGGAGGG - Intronic
1028118405 7:87028353-87028375 GTGTTGAAGAAGAGGGTTGATGG - Intronic
1028118405 7:87028353-87028375 GTGTTGAAGAAGAGGGTTGATGG - Intronic
1028947388 7:96595973-96595995 CTTTGCAGGCATAGGGTGGAGGG + Intronic
1028947388 7:96595973-96595995 CTTTGCAGGCATAGGGTGGAGGG + Intronic
1028998805 7:97130631-97130653 CTGTGATGGCAGAGGGTGGGAGG + Intronic
1028998805 7:97130631-97130653 CTGTGATGGCAGAGGGTGGGAGG + Intronic
1029829117 7:103236689-103236711 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1029829117 7:103236689-103236711 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1029916883 7:104219402-104219424 CTGTAGAAGCAGAGACTTGAAGG - Intergenic
1029916883 7:104219402-104219424 CTGTAGAAGCAGAGACTTGAAGG - Intergenic
1030925700 7:115451522-115451544 CTGATGAAGCAGAGAGTGGGAGG - Intergenic
1030925700 7:115451522-115451544 CTGATGAAGCAGAGAGTGGGAGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031556444 7:123182466-123182488 CAGTGGAGGAAGTGGGTGGAGGG - Intronic
1031556444 7:123182466-123182488 CAGTGGAGGAAGTGGGTGGAGGG - Intronic
1031623028 7:123958582-123958604 CTGTGGAAGGATGGGGTGGGAGG + Intronic
1031623028 7:123958582-123958604 CTGTGGAAGGATGGGGTGGGAGG + Intronic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034325066 7:150222256-150222278 CTGTGGATGCAGATGCTGGTTGG + Intergenic
1034325066 7:150222256-150222278 CTGTGGATGCAGATGCTGGTTGG + Intergenic
1034362324 7:150511108-150511130 CTCTGGAGGCAGAGATTGGAAGG + Intergenic
1034362324 7:150511108-150511130 CTCTGGAGGCAGAGATTGGAAGG + Intergenic
1034492509 7:151401365-151401387 CTGAGGAAACAGAGGGTTTAGGG - Intronic
1034492509 7:151401365-151401387 CTGAGGAAACAGAGGGTTTAGGG - Intronic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035620386 8:1032263-1032285 CTGTGGAGGCAGTGGGCGGCCGG + Intergenic
1035620386 8:1032263-1032285 CTGTGGAGGCAGTGGGCGGCCGG + Intergenic
1035650379 8:1259646-1259668 CTGTGGAAGCAGAGCTGGGCTGG - Intergenic
1035650379 8:1259646-1259668 CTGTGGAAGCAGAGCTGGGCTGG - Intergenic
1036508729 8:9380869-9380891 CTGTGGTTGCAGAGGATGTATGG + Intergenic
1036508729 8:9380869-9380891 CTGTGGTTGCAGAGGATGTATGG + Intergenic
1036596487 8:10217582-10217604 CTGTGGAAGCTGAGCGAGCAAGG - Intronic
1036596487 8:10217582-10217604 CTGTGGAAGCTGAGCGAGCAAGG - Intronic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1037797934 8:22011706-22011728 CTCTGGAGGCTGAGGGGGGAGGG + Intergenic
1037797934 8:22011706-22011728 CTCTGGAGGCTGAGGGGGGAGGG + Intergenic
1038251683 8:25911042-25911064 TGGTGGATGGAGAGGGTGGAGGG - Intronic
1038251683 8:25911042-25911064 TGGTGGATGGAGAGGGTGGAGGG - Intronic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1040983556 8:53269523-53269545 CTCAGGGAGGAGAGGGTGGAAGG + Intergenic
1040983556 8:53269523-53269545 CTCAGGGAGGAGAGGGTGGAAGG + Intergenic
1041541573 8:58990808-58990830 TTGTGGGAGCAGAAGATGGAAGG - Intronic
1041541573 8:58990808-58990830 TTGTGGGAGCAGAAGATGGAAGG - Intronic
1042139721 8:65665729-65665751 CTCAGGAAGCTGAGGGAGGAGGG - Intronic
1042139721 8:65665729-65665751 CTCAGGAAGCTGAGGGAGGAGGG - Intronic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1042374611 8:68035757-68035779 CTGTGGTAGAAGATGGTGAAAGG + Intronic
1042374611 8:68035757-68035779 CTGTGGTAGAAGATGGTGAAAGG + Intronic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042877656 8:73454619-73454641 GTGTTGAAGAAGAGAGTGGATGG - Intronic
1042877656 8:73454619-73454641 GTGTTGAAGAAGAGAGTGGATGG - Intronic
1043458525 8:80436442-80436464 CTCTGGAAGCTGAGGTGGGAGGG + Intergenic
1043458525 8:80436442-80436464 CTCTGGAAGCTGAGGTGGGAGGG + Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044108056 8:88236639-88236661 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
1044108056 8:88236639-88236661 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
1044737088 8:95290101-95290123 TTGAGGAAGCAGTGGGGGGAAGG - Intergenic
1044737088 8:95290101-95290123 TTGAGGAAGCAGTGGGGGGAAGG - Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1045509986 8:102806613-102806635 CTGTTGACTCAGAGGGTGGCCGG + Intergenic
1045509986 8:102806613-102806635 CTGTTGACTCAGAGGGTGGCCGG + Intergenic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045783079 8:105890566-105890588 CTCAGGAAGCTGAGGCTGGAGGG + Intergenic
1045783079 8:105890566-105890588 CTCAGGAAGCTGAGGCTGGAGGG + Intergenic
1045920407 8:107522270-107522292 CTGTTCAGGGAGAGGGTGGAAGG + Intergenic
1045920407 8:107522270-107522292 CTGTTCAGGGAGAGGGTGGAAGG + Intergenic
1045968745 8:108055992-108056014 CTGAGGGACCAGAGGGTGAATGG - Intronic
1045968745 8:108055992-108056014 CTGAGGGACCAGAGGGTGAATGG - Intronic
1046223428 8:111245090-111245112 GCGTGGTAGCAGAGGGTGGATGG + Intergenic
1046223428 8:111245090-111245112 GCGTGGTAGCAGAGGGTGGATGG + Intergenic
1046932405 8:119854992-119855014 CTGGGGCTGCACAGGGTGGAGGG + Intronic
1046932405 8:119854992-119855014 CTGGGGCTGCACAGGGTGGAGGG + Intronic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048308045 8:133297186-133297208 CCGCGGAAGCCGAGGGCGGATGG + Exonic
1048308045 8:133297186-133297208 CCGCGGAAGCCGAGGGCGGATGG + Exonic
1048565627 8:135593718-135593740 TTGTGGAAGCCGAGGCAGGAGGG - Intronic
1048565627 8:135593718-135593740 TTGTGGAAGCCGAGGCAGGAGGG - Intronic
1048771126 8:137896687-137896709 CTGTGGAACAAAAGTGTGGAAGG - Intergenic
1048771126 8:137896687-137896709 CTGTGGAACAAAAGTGTGGAAGG - Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1049211970 8:141391143-141391165 CTCTGGCTGCTGAGGGTGGATGG + Intergenic
1049211970 8:141391143-141391165 CTCTGGCTGCTGAGGGTGGATGG + Intergenic
1049386405 8:142345067-142345089 CTGTGGAGGCACAGGATGGTAGG - Intronic
1049386405 8:142345067-142345089 CTGTGGAGGCACAGGATGGTAGG - Intronic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050360620 9:4827363-4827385 CTGTGGTAGCTGAGGCTGGAGGG + Intronic
1050360620 9:4827363-4827385 CTGTGGTAGCTGAGGCTGGAGGG + Intronic
1051185896 9:14461024-14461046 CTGAGGAACAAGAGGGTGCACGG - Intergenic
1051185896 9:14461024-14461046 CTGAGGAACAAGAGGGTGCACGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1053360507 9:37483240-37483262 CCGTGGAAGCAAAGTGTTGATGG - Intergenic
1053360507 9:37483240-37483262 CCGTGGAAGCAAAGTGTTGATGG - Intergenic
1053390924 9:37735535-37735557 CTGTAACTGCAGAGGGTGGAAGG - Exonic
1053390924 9:37735535-37735557 CTGTAACTGCAGAGGGTGGAAGG - Exonic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1055150933 9:72998746-72998768 CTGTGGAGAAAGAGGGTGTATGG - Intronic
1055150933 9:72998746-72998768 CTGTGGAGAAAGAGGGTGTATGG - Intronic
1055648069 9:78379435-78379457 CTGCTGAAGCAGGGGGTGGTAGG + Intergenic
1055648069 9:78379435-78379457 CTGCTGAAGCAGGGGGTGGTAGG + Intergenic
1055779139 9:79800354-79800376 CTGTGGAAGCTGATGGTGGTGGG + Intergenic
1055779139 9:79800354-79800376 CTGTGGAAGCTGATGGTGGTGGG + Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1057151094 9:92796668-92796690 GTGTGGAAGCAGAGGCTGTGTGG - Intergenic
1057151094 9:92796668-92796690 GTGTGGAAGCAGAGGCTGTGTGG - Intergenic
1057558824 9:96111352-96111374 CTGTGGAAGCAGAAAGTGAGGGG + Intronic
1057558824 9:96111352-96111374 CTGTGGAAGCAGAAAGTGAGGGG + Intronic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1058633994 9:107018856-107018878 CTGTGGAAGAAATGGATGGATGG + Intergenic
1058633994 9:107018856-107018878 CTGTGGAAGAAATGGATGGATGG + Intergenic
1058795835 9:108497678-108497700 ATGTGCAAGCAGAGGGTAGTAGG - Intergenic
1058795835 9:108497678-108497700 ATGTGCAAGCAGAGGGTAGTAGG - Intergenic
1059336821 9:113574375-113574397 CTGTGGAAGTAGAGGCAGCAGGG - Intronic
1059336821 9:113574375-113574397 CTGTGGAAGTAGAGGCAGCAGGG - Intronic
1059354037 9:113686129-113686151 CTCTGGGCGCTGAGGGTGGAGGG + Intergenic
1059354037 9:113686129-113686151 CTCTGGGCGCTGAGGGTGGAGGG + Intergenic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059927219 9:119221862-119221884 GTGTGGAAGCAGAGTTTGAAAGG + Intronic
1059927219 9:119221862-119221884 GTGTGGAAGCAGAGTTTGAAAGG + Intronic
1060216771 9:121743135-121743157 ATGAGGAAGCTGAGGGTGCAAGG - Intronic
1060216771 9:121743135-121743157 ATGAGGAAGCTGAGGGTGCAAGG - Intronic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061090890 9:128425423-128425445 CTTGGGAAGCTGAGGCTGGAGGG + Intronic
1061090890 9:128425423-128425445 CTTGGGAAGCTGAGGCTGGAGGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061239505 9:129361184-129361206 CTGAGGAACAAGAGGGTCGAGGG - Intergenic
1061239505 9:129361184-129361206 CTGAGGAACAAGAGGGTCGAGGG - Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061566612 9:131444883-131444905 CCTTGGAAGCCGAGGGTGGCTGG + Intronic
1061566612 9:131444883-131444905 CCTTGGAAGCCGAGGGTGGCTGG + Intronic
1061927482 9:133813090-133813112 CTGTGGGAACAGGGGGTGGTTGG - Intronic
1061927482 9:133813090-133813112 CTGTGGGAACAGGGGGTGGTTGG - Intronic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1061930311 9:133828991-133829013 CTGTGGGAGCAGAGTGGGGCTGG - Intronic
1061930311 9:133828991-133829013 CTGTGGGAGCAGAGTGGGGCTGG - Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1186357180 X:8800828-8800850 GGGTGGTGGCAGAGGGTGGAGGG - Intronic
1186357180 X:8800828-8800850 GGGTGGTGGCAGAGGGTGGAGGG - Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186782677 X:12929083-12929105 CTGAGGCAGTAGAGGGTTGAGGG + Intergenic
1186782677 X:12929083-12929105 CTGAGGCAGTAGAGGGTTGAGGG + Intergenic
1187522071 X:20022534-20022556 CTGAGGAAGGAGAGGAGGGACGG + Intronic
1187522071 X:20022534-20022556 CTGAGGAAGGAGAGGAGGGACGG + Intronic
1187555540 X:20347858-20347880 CTGTGAAAGCAGAGGAGGAAGGG - Intergenic
1187555540 X:20347858-20347880 CTGTGAAAGCAGAGGAGGAAGGG - Intergenic
1187948118 X:24446240-24446262 CAATGGAAACAGAGGTTGGAGGG + Intergenic
1187948118 X:24446240-24446262 CAATGGAAACAGAGGTTGGAGGG + Intergenic
1188574448 X:31630085-31630107 CTCTGGAAGCAGAGGGTAAGCGG - Intronic
1188574448 X:31630085-31630107 CTCTGGAAGCAGAGGGTAAGCGG - Intronic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189582567 X:42422746-42422768 CTCTGGGGGCATAGGGTGGAAGG + Intergenic
1189582567 X:42422746-42422768 CTCTGGGGGCATAGGGTGGAAGG + Intergenic
1189776484 X:44474484-44474506 CTGTGGGAGTAGAGTGTGGCTGG + Intergenic
1189776484 X:44474484-44474506 CTGTGGGAGTAGAGTGTGGCTGG + Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1189838239 X:45042237-45042259 CCGTGGAAGGAGACCGTGGAGGG + Intronic
1189838239 X:45042237-45042259 CCGTGGAAGGAGACCGTGGAGGG + Intronic
1190096284 X:47483257-47483279 CTGTGGGCGCAGAGGGTTGCGGG + Intergenic
1190096284 X:47483257-47483279 CTGTGGGCGCAGAGGGTTGCGGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1191116436 X:56857839-56857861 CTGTGGCTTCAGAGGGTGAAAGG - Intergenic
1191116436 X:56857839-56857861 CTGTGGCTTCAGAGGGTGAAAGG - Intergenic
1192224329 X:69217860-69217882 GTTTGGAAGTAGAGGCTGGATGG + Intergenic
1192224329 X:69217860-69217882 GTTTGGAAGTAGAGGCTGGATGG + Intergenic
1192239528 X:69318424-69318446 CTGTGGAAGGAGTGGGAGGTTGG + Intergenic
1192239528 X:69318424-69318446 CTGTGGAAGGAGTGGGAGGTTGG + Intergenic
1192567484 X:72177413-72177435 CTATGGAGGCAGACTGTGGAGGG - Intergenic
1192567484 X:72177413-72177435 CTATGGAGGCAGACTGTGGAGGG - Intergenic
1192638458 X:72842902-72842924 CTGAGGTAGCAGAGAGGGGAAGG - Intronic
1192638458 X:72842902-72842924 CTGAGGTAGCAGAGAGGGGAAGG - Intronic
1192643256 X:72877906-72877928 CTGAGGTAGCAGAGAGGGGAAGG + Intronic
1192643256 X:72877906-72877928 CTGAGGTAGCAGAGAGGGGAAGG + Intronic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1194876956 X:99201183-99201205 CTGTGGCTTCAGAGGGTGGAAGG + Intergenic
1194876956 X:99201183-99201205 CTGTGGCTTCAGAGGGTGGAAGG + Intergenic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195679288 X:107531719-107531741 GTGTGGTAGCAGAGGGTGGAGGG - Intronic
1195679288 X:107531719-107531741 GTGTGGTAGCAGAGGGTGGAGGG - Intronic
1196093923 X:111777868-111777890 CTGTGGAAACACAGAGAGGAGGG - Intronic
1196093923 X:111777868-111777890 CTGTGGAAACACAGAGAGGAGGG - Intronic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1197647762 X:129036448-129036470 CTGTGAAAGAATTGGGTGGAGGG - Intergenic
1197647762 X:129036448-129036470 CTGTGAAAGAATTGGGTGGAGGG - Intergenic
1197865758 X:131014984-131015006 GTGTGGGAGCAGAGGGTATATGG - Intergenic
1197865758 X:131014984-131015006 GTGTGGGAGCAGAGGGTATATGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198095716 X:133378000-133378022 CTCTGGAAGCTGAGGTCGGAGGG - Intronic
1198095716 X:133378000-133378022 CTCTGGAAGCTGAGGTCGGAGGG - Intronic
1198672024 X:139091326-139091348 CTCTGCAAGCAGAGGGTGGGAGG + Intronic
1198672024 X:139091326-139091348 CTCTGCAAGCAGAGGGTGGGAGG + Intronic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200742368 Y:6868142-6868164 CTGTGGCAGCAGGGGCTGCATGG + Exonic
1200742368 Y:6868142-6868164 CTGTGGCAGCAGGGGCTGCATGG + Exonic
1201144803 Y:11058300-11058322 GGGTGGAAGCATAGAGTGGAGGG + Intergenic
1201144803 Y:11058300-11058322 GGGTGGAAGCATAGAGTGGAGGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic