ID: 997737769

View in Genome Browser
Species Human (GRCh38)
Location 5:136227080-136227102
Sequence ACCTCCTACAAACTACACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997737769_997737770 0 Left 997737769 5:136227080-136227102 CCTGAGTGTAGTTTGTAGGAGGT 0: 1
1: 0
2: 1
3: 5
4: 97
Right 997737770 5:136227103-136227125 GATCCAGTTGTGTTCTCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 128
997737769_997737774 18 Left 997737769 5:136227080-136227102 CCTGAGTGTAGTTTGTAGGAGGT 0: 1
1: 0
2: 1
3: 5
4: 97
Right 997737774 5:136227121-136227143 TCTGGGGTAGACTTAAACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 106
997737769_997737771 1 Left 997737769 5:136227080-136227102 CCTGAGTGTAGTTTGTAGGAGGT 0: 1
1: 0
2: 1
3: 5
4: 97
Right 997737771 5:136227104-136227126 ATCCAGTTGTGTTCTCTTCTGGG 0: 1
1: 0
2: 2
3: 91
4: 826
997737769_997737772 2 Left 997737769 5:136227080-136227102 CCTGAGTGTAGTTTGTAGGAGGT 0: 1
1: 0
2: 1
3: 5
4: 97
Right 997737772 5:136227105-136227127 TCCAGTTGTGTTCTCTTCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997737769 Original CRISPR ACCTCCTACAAACTACACTC AGG (reversed) Intronic
902126343 1:14215315-14215337 AAATCCTACAAGCCACACTCTGG - Intergenic
906146719 1:43564936-43564958 GCCCCCTACAAAGTACACACAGG - Intronic
909336804 1:74484688-74484710 TCCTCTTACACACTCCACTCTGG - Intronic
911953510 1:104207551-104207573 ATCTTCTACGAACTACTCTCTGG - Intergenic
916031179 1:160878812-160878834 ACCTTCTAGAAACCTCACTCAGG - Intronic
916187261 1:162145452-162145474 ACCTCCTACTAAATACTCTGGGG - Intronic
922786432 1:228284762-228284784 ACCTCCTGCAAACTCAGCTCTGG - Intronic
1064880003 10:20040590-20040612 AGCTCCTGCAAGCTACAGTCTGG - Intronic
1066749604 10:38639774-38639796 AACTCTTAGAAAATACACTCTGG - Intergenic
1066967041 10:42278005-42278027 AACTCTTAGAAAATACACTCTGG + Intergenic
1079247464 11:18763228-18763250 ACCTCCTCCAAACTCCTGTCTGG + Intronic
1090752668 11:129760881-129760903 ACCTCCTGCAATCTAAGCTCTGG - Intergenic
1098992304 12:77077223-77077245 TGCTGCTACAAACTACCCTCTGG + Intergenic
1102673378 12:114638850-114638872 ATCTCCTAGAAACTCCATTCTGG - Intergenic
1107385676 13:39906041-39906063 TCCTCCTTCAAACTATATTCAGG - Intergenic
1108924286 13:55719837-55719859 ACCTCCTTCATACTGCACTCTGG - Intergenic
1110647668 13:77906966-77906988 ACCTCCTTCAAACCACTGTCGGG - Intronic
1111363004 13:87200967-87200989 TCCTCCTACCCTCTACACTCAGG - Intergenic
1112823067 13:103358121-103358143 ACCTACTGCAAACTTCATTCTGG + Intergenic
1115931258 14:38498086-38498108 ACCTACTAAATACTACAGTCTGG - Intergenic
1115960770 14:38834872-38834894 CCATCCTACAAATTCCACTCTGG + Intergenic
1117602048 14:57386198-57386220 CCCTTCTTCAAACAACACTCTGG - Intergenic
1118016824 14:61669241-61669263 TGCACCTACAAACAACACTCTGG + Intergenic
1121888435 14:97566450-97566472 ACCTACTATATACTACACACTGG + Intergenic
1124012927 15:25853142-25853164 AATTCATACAAACTGCACTCCGG + Intronic
1124150458 15:27173062-27173084 CCTTCCTGCAAACTTCACTCTGG + Intronic
1126180163 15:45777472-45777494 ATCTCCCACAAATTACACTGAGG - Intergenic
1126225905 15:46268831-46268853 CCCTCCTACAGATTAAACTCTGG + Intergenic
1127541808 15:59946784-59946806 ATCTGCTGCAAAATACACTCAGG - Intergenic
1129136363 15:73555688-73555710 ACCTCCTACGTACTAGACACTGG - Intronic
1135615798 16:23909938-23909960 ACCTCCTAAAAGCAACACACTGG + Intronic
1136061875 16:27732238-27732260 ACCTACTATAAGCCACACTCTGG - Intronic
1136578091 16:31135923-31135945 ACCACATACACACTACACACCGG - Intergenic
1136733112 16:32437356-32437378 AACTCTTAGAAAATACACTCTGG + Intergenic
1138422390 16:56907797-56907819 ACCTCCTAAAACCATCACTCTGG + Intronic
1203019971 16_KI270728v1_random:392247-392269 AACTCTTAGAAAATACACTCTGG - Intergenic
1203038306 16_KI270728v1_random:665405-665427 AACTCTTAGAAAATACACTCTGG - Intergenic
1144133681 17:12272166-12272188 AGCTCCTACAAAATACATGCTGG - Intergenic
1153376675 18:4388362-4388384 ACCTCCTACATACTTCCCTATGG - Intronic
1153653856 18:7264805-7264827 ACCTCCTTCTAATTGCACTCAGG - Intergenic
1155655847 18:28192359-28192381 ACATCCTAGAAAATACATTCTGG + Intergenic
930154859 2:48095751-48095773 ACCTCCTACAATCTGTAATCAGG - Intergenic
930917258 2:56708193-56708215 ACCTCCTCCAAACTCCAGTCAGG + Intergenic
932888477 2:75569572-75569594 ACCTCTTACAAAATAAAATCAGG + Exonic
934763145 2:96867220-96867242 ACCTCCCACAGGCTCCACTCGGG - Intronic
939622021 2:144431894-144431916 ACCTCCTAAAAACTGATCTCTGG + Intronic
940945783 2:159615986-159616008 TCCTCCCCCAAACTCCACTCGGG + Intronic
941578335 2:167264434-167264456 ACCTCCTACACATTAATCTCTGG + Intergenic
946464975 2:219903809-219903831 ACATCCTGCAACCTGCACTCTGG + Intergenic
946951721 2:224883306-224883328 ACATGCTAGAAACTACACCCAGG - Intronic
1180253881 21:46609018-46609040 ACCTGCTAGAAACTTCACTGAGG - Intergenic
1180539348 22:16427738-16427760 AACTCTTAGAAAATACACTCTGG - Intergenic
1184192675 22:42905420-42905442 ACCTCAGACAAAATAAACTCTGG + Intronic
1185016323 22:48345213-48345235 ACTTCCTTCAAACTACACAAGGG - Intergenic
953120058 3:40031293-40031315 ACCTCCTAAAAACATCACACTGG + Intronic
969861709 4:10041073-10041095 TCCTACTGCAAACAACACTCAGG + Intronic
971663690 4:29455206-29455228 TCCTTCTACAAACTACAGTCTGG + Intergenic
972262896 4:37428570-37428592 AGCTACTAAAAACTAAACTCTGG - Intronic
973067573 4:45816192-45816214 AGCTCCTACAAGCTGCAGTCAGG + Intergenic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
975980833 4:80157450-80157472 ACCTCCTACAGTCCACCCTCTGG + Intergenic
977944806 4:102899914-102899936 AACTCTTAGAAAATACACTCTGG - Intronic
979045779 4:115861319-115861341 ACCACTTACAAACTACCCTTAGG - Intergenic
979323863 4:119356179-119356201 AACTACTACAAACAACATTCAGG - Intergenic
983241703 4:165240856-165240878 AACTACTACAAACAACATTCAGG - Intronic
989513100 5:42311015-42311037 ACCTTCTACCAGCTACAGTCTGG - Intergenic
989513377 5:42314581-42314603 ACCTTCTACCAGCTACAGTCTGG + Intergenic
990284630 5:54288743-54288765 ACCTACTACAAATAACACTTTGG + Intronic
992228787 5:74643126-74643148 ACCTCCTACAAACTGTACTCTGG + Intronic
997737769 5:136227080-136227102 ACCTCCTACAAACTACACTCAGG - Intronic
1002855461 6:1033964-1033986 ACCTCGTACAAACCTCACACAGG - Intergenic
1007413830 6:41680440-41680462 GCCTCCTAAAAACTAACCTCAGG - Intergenic
1010662060 6:78583207-78583229 ACCTCCTAAAAACTAGGCTTGGG - Intergenic
1010779863 6:79933153-79933175 AGGTCTTACAAACTACACTGAGG + Intronic
1013743512 6:113317791-113317813 ACCACCTACATACAACACTTGGG + Intergenic
1014289600 6:119542874-119542896 ACATCCTAGAAATTTCACTCAGG - Intergenic
1015908626 6:138144373-138144395 AAATACTACAAACTACACTCAGG + Intergenic
1018886747 6:167944837-167944859 CCATCCTACAAGCTCCACTCAGG - Intronic
1019951751 7:4378820-4378842 ACCTCCTACAAAGGAAACCCTGG + Intergenic
1020447559 7:8285261-8285283 ATCTGCTACAATCTACCCTCTGG - Intergenic
1021187965 7:17587445-17587467 ACATCCTATGAACTACACTTAGG + Intergenic
1024494894 7:50034422-50034444 ACCTGATTCAAACTACAATCTGG + Intronic
1028405286 7:90467480-90467502 GCTTCCTACAAGCTACTCTCAGG - Intronic
1031737638 7:125386310-125386332 ACCTCCAACCAAATACACTGAGG - Intergenic
1032846654 7:135757119-135757141 ACCTCCTAGTAACTTCATTCTGG - Intergenic
1038537001 8:28360668-28360690 ACCTTCTACAGACAACACTGTGG + Intronic
1039026505 8:33264158-33264180 AAATTTTACAAACTACACTCTGG + Intergenic
1043909041 8:85839236-85839258 AGCTCCTCCAAACTACATTAAGG + Intergenic
1046884634 8:119352031-119352053 AATTCAGACAAACTACACTCAGG + Intergenic
1051123340 9:13775718-13775740 CCCTCCTACCAAATACACACAGG + Intergenic
1051859546 9:21608781-21608803 TCCTCCTGAAAACTACACACAGG - Intergenic
1052894227 9:33732158-33732180 ACCTCCTGCAATCTAAGCTCTGG - Intergenic
1055307238 9:74942648-74942670 AGCTCCTAGAAACCACTCTCAGG + Intergenic
1057006985 9:91569119-91569141 ACCCCCTACAAGCTGCCCTCAGG + Intronic
1058175100 9:101726337-101726359 ATCTGCTACAAACTCCTCTCGGG - Intronic
1059576283 9:115492268-115492290 AGCTACTACAAACTATTCTCGGG + Intergenic
1061077867 9:128352792-128352814 CCCTCTTCCCAACTACACTCCGG + Intronic
1187068571 X:15865304-15865326 ACCTCCTAGAGACTACTCTGAGG - Intergenic
1188545839 X:31305739-31305761 ACCTCCAACAAACTTCACCTAGG + Intronic
1190491563 X:50987989-50988011 ACTTCCTACACACTAAGCTCTGG - Intergenic
1194003092 X:88456338-88456360 ACCTACTACAATCTGCTCTCTGG - Intergenic
1196399733 X:115301190-115301212 ACCTTCTGGAAGCTACACTCAGG - Intronic
1197167987 X:123399936-123399958 ACCTCCATAAAACTACACTTAGG - Intronic
1199499300 X:148492482-148492504 AACTTCTAGAAACTACACTTTGG + Intergenic