ID: 997739742

View in Genome Browser
Species Human (GRCh38)
Location 5:136243134-136243156
Sequence CTGTCCCAAGGGGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 353}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997739742_997739748 -1 Left 997739742 5:136243134-136243156 CCTTCCTCTTCCCCTTGGGACAG 0: 1
1: 0
2: 5
3: 37
4: 353
Right 997739748 5:136243156-136243178 GTGCTACAACATGGTGAGACTGG 0: 1
1: 0
2: 1
3: 8
4: 115
997739742_997739751 19 Left 997739742 5:136243134-136243156 CCTTCCTCTTCCCCTTGGGACAG 0: 1
1: 0
2: 5
3: 37
4: 353
Right 997739751 5:136243176-136243198 TGGTTTTTGTGAGCTGGCCTGGG 0: 1
1: 0
2: 2
3: 38
4: 285
997739742_997739747 -10 Left 997739742 5:136243134-136243156 CCTTCCTCTTCCCCTTGGGACAG 0: 1
1: 0
2: 5
3: 37
4: 353
Right 997739747 5:136243147-136243169 CTTGGGACAGTGCTACAACATGG 0: 1
1: 0
2: 1
3: 16
4: 101
997739742_997739750 18 Left 997739742 5:136243134-136243156 CCTTCCTCTTCCCCTTGGGACAG 0: 1
1: 0
2: 5
3: 37
4: 353
Right 997739750 5:136243175-136243197 CTGGTTTTTGTGAGCTGGCCTGG 0: 1
1: 0
2: 0
3: 23
4: 212
997739742_997739749 13 Left 997739742 5:136243134-136243156 CCTTCCTCTTCCCCTTGGGACAG 0: 1
1: 0
2: 5
3: 37
4: 353
Right 997739749 5:136243170-136243192 TGAGACTGGTTTTTGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997739742 Original CRISPR CTGTCCCAAGGGGAAGAGGA AGG (reversed) Intronic
900548551 1:3242048-3242070 CTTTCCCACTGGGAACAGGAGGG + Intronic
900926628 1:5710115-5710137 GTGCCCCAAAGGAAAGAGGAAGG - Intergenic
901421546 1:9154538-9154560 CTGACTCAGGAGGAAGAGGAAGG - Intergenic
901577894 1:10215548-10215570 CTGTCTCAAGGGGAAAAAAACGG - Intronic
901614559 1:10528081-10528103 CTGCCCTAAGGGCAAGAAGATGG - Intronic
902651086 1:17838088-17838110 CTGTGCAAAGGCGCAGAGGAGGG + Intergenic
902785074 1:18727954-18727976 CTGTCCACAGGGGGAAAGGAGGG + Intronic
904573182 1:31483366-31483388 CTCTCCCCAGGGGAAGCAGATGG + Intergenic
905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG + Intergenic
905916824 1:41690307-41690329 CTGGCTCAAGGGGCAGGGGATGG + Intronic
906507698 1:46392661-46392683 CCTTCCCTAGGGGAAGGGGAAGG - Intergenic
906614736 1:47226275-47226297 CAGGCCTAAAGGGAAGAGGAGGG + Intronic
908958859 1:69670745-69670767 TTCTCCCAATGGAAAGAGGAGGG - Intronic
909943534 1:81637173-81637195 CTGACCCAAAAGGAATAGGATGG + Intronic
911143809 1:94533450-94533472 CTGGCCCAAGGGGAAGACAATGG + Intronic
912368111 1:109151413-109151435 GTGTCCCATTGTGAAGAGGAGGG - Intronic
913070659 1:115295478-115295500 GTGTCCCCAGGGTAAGAGGTGGG + Intronic
913524996 1:119682589-119682611 CTTTCCCTAGGGGAAAAGAAAGG - Intronic
914676934 1:149913037-149913059 CTGACCCAAGGCCAAGAAGAGGG + Intronic
914827042 1:151144162-151144184 TTGTTCCCAGGGGAAGAGAAAGG + Intronic
915447207 1:155980504-155980526 ATCTCCTAAGGGGAAGAAGAGGG - Intronic
915577642 1:156791050-156791072 CAGACCCTAGAGGAAGAGGAGGG - Intronic
916321046 1:163504669-163504691 CTTTGCAAAGGGGGAGAGGATGG + Intergenic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
917630772 1:176889247-176889269 CTATCCCAAGGGGAGGGAGAGGG + Intronic
919814428 1:201428659-201428681 CTGTCCCCAGGGGCAGCTGATGG + Intronic
920210822 1:204327058-204327080 CTATCCCAGGAGGAGGAGGAGGG - Intronic
921159986 1:212465790-212465812 CAGTCCCCAGGTGAGGAGGAGGG + Intergenic
921398565 1:214694709-214694731 CTCCCACAAGGGGAAGAAGAGGG - Intergenic
921553983 1:216574914-216574936 CTTTCCCAAGGGAAGGAGGGAGG - Intronic
922005727 1:221528944-221528966 CTGTCCCCAGGGAAATAGAAGGG - Intergenic
923746820 1:236708878-236708900 CTGACTAAAGTGGAAGAGGAAGG - Intronic
1063655419 10:7983266-7983288 CTGTCAGAAGGGGAAGTGGTAGG + Intronic
1063829148 10:9932266-9932288 CTGTCCCTAGGGTAAGAACATGG - Intergenic
1065119991 10:22519317-22519339 AAGACCCAATGGGAAGAGGAGGG + Intergenic
1068700991 10:60019329-60019351 CTATCCCAATGGTAAAAGGATGG + Intergenic
1069720181 10:70544803-70544825 CTGTGCCCAGGGGAGTAGGAGGG - Intronic
1069939028 10:71940805-71940827 CTTTCCCTTGGGGAAGAGGAAGG + Intergenic
1070653920 10:78257945-78257967 CTGACTGAAAGGGAAGAGGAGGG - Intergenic
1072974252 10:100043956-100043978 CTATCCCAGGCTGAAGAGGAAGG + Intronic
1073077129 10:100831106-100831128 CTGTCCCAAGCCAAAGGGGAAGG - Intergenic
1073454775 10:103629865-103629887 CTGTCCCCCTGGGGAGAGGAGGG + Intronic
1074600395 10:114907984-114908006 TAGTCCAAAGGGGAAGGGGAAGG + Intergenic
1076438080 10:130459958-130459980 GTTCCCCAAGGTGAAGAGGAGGG + Intergenic
1076826082 10:132970168-132970190 CTCTCCCGAGGGGAAGAAGTTGG + Intergenic
1077140420 11:1021889-1021911 CTGGCCCAAGTGGTGGAGGAGGG - Intronic
1077225192 11:1436523-1436545 CAGGCCCCAGTGGAAGAGGAAGG - Intronic
1077398197 11:2336985-2337007 CCTTCCCTAGGGGAAGGGGAAGG + Intergenic
1078791746 11:14549868-14549890 CTGCTCCAATGGCAAGAGGATGG + Intronic
1079401663 11:20110984-20111006 CTGTCATCAGGGGATGAGGATGG + Intronic
1080179437 11:29406285-29406307 CAGTCCTATGGGGAAGAGGGAGG + Intergenic
1081117829 11:39226644-39226666 ATGTCCCAAGAGGAAAAGTAAGG + Intergenic
1081742372 11:45449633-45449655 CTTTCCCCAGGGTAAGAGGGTGG - Intergenic
1081872097 11:46387893-46387915 TTGTCCCAGAGGGAAGAGAAGGG + Intergenic
1083042599 11:59702107-59702129 CTGTCCGAGGGGGAAGGGGAGGG - Intergenic
1084564499 11:69921436-69921458 GTGTCCCAAGAGAAGGAGGAGGG + Intergenic
1084871207 11:72099667-72099689 CTGGTCCTAGGGGATGAGGAAGG - Intronic
1085195665 11:74670223-74670245 CAGCCCCAAGGGGAAGAGACTGG - Intergenic
1085509711 11:77082114-77082136 CTGTCCCAGGGGCACCAGGATGG + Intronic
1087595094 11:100243433-100243455 CTGTCCCAAGGTGGAGATCAAGG - Intronic
1088036774 11:105326670-105326692 TTGACCCAAGGAGAGGAGGAAGG + Intergenic
1088661583 11:112052759-112052781 CTGACCTAAGGGAAAGGGGAGGG - Intronic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1090333914 11:125950471-125950493 CTGTGGGAAGGGGAAGGGGAAGG + Intergenic
1090444554 11:126752744-126752766 CTTTCCCAAAGTGAAGAGCATGG + Intronic
1090454467 11:126836030-126836052 CTGACTCCAGGGGAAGAAGATGG + Intronic
1090599609 11:128356844-128356866 CTGTCCCCAGGAGAGGAGGCTGG - Intergenic
1090644844 11:128758960-128758982 CTTGCCCAAGGGGCAGAGGCAGG - Intronic
1090653837 11:128827506-128827528 CTGTTGCAAAGTGAAGAGGAAGG - Intergenic
1091356081 11:134938627-134938649 CTGGAGCAAGGGGATGAGGATGG + Intergenic
1091849549 12:3684243-3684265 CTGTACCACAGGGAAGAGGGTGG - Intronic
1094052876 12:26239755-26239777 CTCTCCCAAGTGGAAGACAATGG - Intronic
1094426471 12:30321645-30321667 GAGTCCCAATGGGAAGAGGATGG - Intergenic
1096099109 12:48957989-48958011 CTTTCCCATAAGGAAGAGGAAGG + Intergenic
1096567928 12:52496681-52496703 CTGTCCCCTGGGGAGGAGGCTGG - Intergenic
1096688906 12:53307541-53307563 GGGTCCCAAGGGGCAGAGGTTGG + Exonic
1097188868 12:57210099-57210121 CTGTCCCAATGGGAAGCGGCTGG + Exonic
1099107795 12:78518722-78518744 CCGTCCCAATGAGATGAGGAGGG - Intergenic
1100580303 12:95932823-95932845 CCTTCCCAAGAGGAACAGGATGG + Intronic
1102453436 12:113057292-113057314 CTGCCCCAAGGGAAAGCGGGCGG + Intronic
1102781908 12:115572830-115572852 CTGCGGCACGGGGAAGAGGAGGG - Intergenic
1103414806 12:120736976-120736998 CTGTGCCCAGGTGAAGAAGATGG + Exonic
1103471962 12:121189420-121189442 ACTTCCCAAGAGGAAGAGGAGGG - Intergenic
1103562921 12:121801362-121801384 CTGCCCCAAGGGCGAGAAGACGG - Intronic
1104825074 12:131702143-131702165 CTGCCCAAAGGGGTAGAGGGAGG - Intergenic
1108792156 13:53983185-53983207 GTTTTCCAAGGGGAAGAGAAAGG + Intergenic
1111675279 13:91379224-91379246 GTGTCCCAGAAGGAAGAGGAAGG - Intergenic
1112527519 13:100166133-100166155 TTGCCTAAAGGGGAAGAGGAAGG - Intronic
1112642066 13:101286489-101286511 CTGTGCAAAGTGGAACAGGAAGG + Intronic
1112676281 13:101705812-101705834 CTGTCCCTGGGAGAAGAGCAGGG + Intronic
1113348936 13:109509042-109509064 GTGGCCCAAGGAGAAAAGGAAGG + Intergenic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114633949 14:24177118-24177140 CTGTCCAGAGAGGAAGAGCAAGG - Intronic
1114669497 14:24401290-24401312 CTTTCCCAAAGGGAAGACAAAGG - Intronic
1116467668 14:45252711-45252733 GGGTCCCAAGGGGAAGAGTTGGG + Intronic
1117920887 14:60724166-60724188 CTTTCCGGAGGGGGAGAGGAGGG - Intronic
1118592934 14:67414412-67414434 CTCACCCATAGGGAAGAGGATGG + Intergenic
1119159177 14:72438924-72438946 CTGTCCAGAGGGCAAGAGGCAGG - Intronic
1119326272 14:73761247-73761269 CTTTCTCAGGGAGAAGAGGAGGG + Intronic
1119765137 14:77183077-77183099 CTGTCCCAGGGAGAAGAACAAGG - Intronic
1120309305 14:82809759-82809781 CTCTGCCAAGGGGAAGGGCAGGG - Intergenic
1120771520 14:88385431-88385453 CTGTCCCTGCGGGAAGAGCAGGG - Intronic
1123166095 14:106326552-106326574 CCATCCCAAGGGGTAGAGGGTGG - Intergenic
1123192925 14:106588632-106588654 CCGTCCCAAGGGGTAGAGGCTGG - Intergenic
1126578683 15:50222250-50222272 CTGTCCCAGTGGGATGGGGAGGG - Intronic
1126678917 15:51185537-51185559 CTGTCCTAGGAGGAAGAGGAAGG + Intergenic
1127128561 15:55837545-55837567 CTGTCCTAAAGTGAAGAGAATGG + Intronic
1128220876 15:65967713-65967735 CAGTGACAAGGAGAAGAGGACGG + Intronic
1128350006 15:66882178-66882200 CTGTCCCAGGGAGAGGAGGCCGG + Intergenic
1129787663 15:78320286-78320308 CCATCCCCAGTGGAAGAGGATGG + Intergenic
1129808056 15:78481138-78481160 CTGTCCCTAGAGAAAGGGGATGG + Intronic
1129832179 15:78678117-78678139 CAGTGCCTAGGGGAAGAGGCAGG - Intronic
1130705834 15:86232244-86232266 CCGTCCCAAGGGGACAGGGATGG - Intronic
1131091083 15:89625362-89625384 CTGGCCCAGGAGGAAGAGGGCGG + Exonic
1132565907 16:622873-622895 GTGTCTCAAGGGGCAGAGCACGG - Intronic
1132679089 16:1132432-1132454 CTGCCCCACGGGGAGCAGGAGGG - Intergenic
1132854395 16:2038420-2038442 GCGTCCCAAGGGGGAGGGGAAGG - Exonic
1135736714 16:24937645-24937667 CTTTCCCAAGGTGAAGAAAATGG + Intronic
1136510751 16:30737106-30737128 CTACCCCAAGAGGAGGAGGAGGG + Exonic
1136653806 16:31696592-31696614 CTGCCCCAGGCAGAAGAGGAGGG + Intergenic
1137270635 16:46900385-46900407 CTGTCCCTAGCGGAAGAGCTTGG + Intronic
1137379948 16:47987951-47987973 CCCTCCCAAGGTGAAGAGAAAGG - Intergenic
1137758988 16:50925391-50925413 CTGTCCAAAGGGGAAGACTCTGG - Intergenic
1139056289 16:63188992-63189014 TTTTCTCAAAGGGAAGAGGATGG - Intergenic
1140134932 16:72197608-72197630 CTGACCCCAGTGGAGGAGGAGGG - Intergenic
1141101176 16:81198607-81198629 AAGTCACAAAGGGAAGAGGAGGG + Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1141886421 16:86895428-86895450 ATGCCCCAAGGGAAAAAGGAAGG - Intergenic
1141994259 16:87626728-87626750 ATGTTCCAAGGGGAAGTGGCGGG + Intronic
1142110734 16:88329703-88329725 CTGTTCCAGGGGAAAGGGGACGG + Intergenic
1142129173 16:88424961-88424983 CTGTCCTGAGAGGGAGAGGAAGG - Intergenic
1142151439 16:88514295-88514317 TTGGCCCAAGGGGCAGTGGAGGG - Intronic
1142251726 16:88994970-88994992 CTTCTCCAAGGGGAAGGGGAAGG - Intergenic
1143789517 17:9282457-9282479 CTCTACCAAGGCAAAGAGGAGGG - Intronic
1143808960 17:9454822-9454844 CTGTTCTAGGGGGCAGAGGATGG + Intronic
1144476622 17:15594593-15594615 GGGTCCCAGGTGGAAGAGGAGGG + Intronic
1144518811 17:15940710-15940732 TTATTCCATGGGGAAGAGGAAGG - Intergenic
1144549122 17:16224183-16224205 CTGTCGCAAGAGCAAGAGGCTGG - Intronic
1144737133 17:17561487-17561509 CTGCCCGAGGGGGAAGCGGACGG + Intronic
1144782376 17:17814550-17814572 CAGTGCCCAGGGGATGAGGAAGG + Intronic
1144887268 17:18471800-18471822 CTGTCCCTAGGGAGTGAGGAGGG - Intergenic
1144921630 17:18768809-18768831 GGGTCCCAGGTGGAAGAGGAGGG - Intronic
1144930374 17:18854204-18854226 TTTTCCCCAGTGGAAGAGGATGG - Intronic
1144946795 17:18973463-18973485 CCAGCCCAAGGGGTAGAGGATGG - Intronic
1145144948 17:20472495-20472517 CTGTCCCTAGGGAGTGAGGAGGG + Intergenic
1146398260 17:32485670-32485692 CTGTCCTAGGGGGAACAGAAAGG - Intergenic
1146640512 17:34537212-34537234 CTTGACCAAAGGGAAGAGGAGGG + Intergenic
1147180868 17:38684871-38684893 ATGACCCTAGAGGAAGAGGAAGG + Intergenic
1147754330 17:42758424-42758446 CTGTAGCAATGGGTAGAGGAAGG - Intergenic
1148840037 17:50489158-50489180 AGGTCCCAGGGTGAAGAGGATGG + Intergenic
1149588818 17:57812122-57812144 CTGTCACCAGGGGCAGGGGAAGG - Intergenic
1151332516 17:73419115-73419137 CAGTCCCAAGGGGAAAGGCATGG - Intronic
1151864211 17:76789303-76789325 CTGCCCCAAGGGGAAAATTAAGG - Intergenic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152037283 17:77881155-77881177 CTGCCCCAGGTGGAAGGGGAGGG - Intergenic
1152135652 17:78501707-78501729 CTGTCCCAGGGGCCAGGGGAAGG - Intronic
1152339547 17:79716538-79716560 GAGTCCCAAGGGGAGGGGGAGGG + Intergenic
1152383676 17:79956010-79956032 CTGTGCCAAGAGGAAGAGTGAGG - Intronic
1152622155 17:81370399-81370421 CAGGTCCTAGGGGAAGAGGAAGG + Intergenic
1153213372 18:2792555-2792577 ATGTCCCATGAGGAAAAGGAGGG + Intronic
1153617199 18:6945947-6945969 CAGCCCCAAAGGGGAGAGGAAGG + Intronic
1154498534 18:14980677-14980699 CTGGAGCAAGGGGATGAGGATGG - Intergenic
1154981410 18:21505352-21505374 CTGACACATGGGGAAGAGGGAGG + Intronic
1155219647 18:23672481-23672503 CAGTCTCCAGGGGAAGATGAAGG + Intergenic
1155554702 18:27005785-27005807 CTGCCCCTAGTGGAAGAAGAAGG - Intronic
1156519038 18:37706027-37706049 CTGTCCAAAGCGGGAGAGCAGGG - Intergenic
1157429861 18:47615759-47615781 CCTTCCCAAGGGGGAAAGGAAGG + Intergenic
1157820213 18:50761807-50761829 ATTTCCCAAGGTGAAGGGGATGG - Intergenic
1160474935 18:79174516-79174538 CTGTACCAAGCGCAAGAGAAGGG - Intronic
1161769654 19:6224284-6224306 CTGTCCCAGGTGGAAGAGCCAGG - Intronic
1162095277 19:8306467-8306489 CTGGGCCAAGGGACAGAGGAAGG + Intronic
1162536150 19:11263696-11263718 CTCTACCAAGAGGAAGAGGTGGG + Intergenic
1162726805 19:12694869-12694891 CTGTCCCGCTGGGCAGAGGATGG - Exonic
1162877303 19:13630188-13630210 CTGTCCCAGGAGGAAGAGGAGGG + Intergenic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1164082865 19:21875714-21875736 ATGTCCCAGGCAGAAGAGGAAGG - Intergenic
1164190847 19:22915833-22915855 ATGTCCCAGGCAGAAGAGGAAGG - Intergenic
1164500073 19:28811821-28811843 CTGGACTAAGGGGAAGTGGAAGG - Intergenic
1166870278 19:45866548-45866570 CTGACCCAAGGGGAAGAGGTGGG - Intronic
1167524515 19:49975296-49975318 CTGCCCCAAGGGGCAGAGGATGG + Intergenic
1167566711 19:50261497-50261519 CTGTCCCACGCGGTAGAGGTTGG - Exonic
1167791296 19:51684371-51684393 ATGGCCCAAGGTGAAGAGAAAGG + Intergenic
1168233909 19:55049938-55049960 CAGCTCCAAAGGGAAGAGGAAGG - Intronic
1168720584 19:58552610-58552632 GTGGCCCAAGAGGCAGAGGAGGG - Intronic
926115138 2:10208262-10208284 CAGTCCTAAGGGGAAGGGGCTGG + Intronic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
927892292 2:26759202-26759224 CTGTCCCAAGGGGCAGACTGGGG - Intergenic
930179715 2:48341682-48341704 CTGTGCCAAGAGGAAGAACATGG + Intronic
930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG + Intronic
931459842 2:62441104-62441126 CTGTCCCAGGAGGAGAAGGATGG + Intergenic
931906982 2:66853191-66853213 CTGTGACAATGGGAAGCGGAAGG - Intergenic
932676414 2:73785456-73785478 ATATCCCAAGGGGAAAAGTAGGG - Intronic
932677000 2:73790357-73790379 ATATCCCAAGGGGAAAAGTAGGG - Intronic
932677585 2:73795254-73795276 ATATCCCAAGGGGAAAAGTAGGG - Intronic
932678171 2:73800152-73800174 ATATCCCAAGGGGAAAAGTAGGG - Intronic
932678757 2:73805052-73805074 ATATCCCAAGGGGAAAAGTAGGG - Intronic
932679333 2:73809939-73809961 ATATCCCAAGGGGAAAAGTAGGG - Intronic
932769676 2:74493535-74493557 CTGGACCAAGAGGAAGAGAAAGG - Exonic
935618524 2:105109381-105109403 CTGTCCCAAGGGGAAAGTGAAGG + Intergenic
937636139 2:124157216-124157238 CTCTACCCAGGGGAAGAGGGTGG - Intronic
937648241 2:124290086-124290108 CAGTTCCAAGGGGAAGTCGAGGG - Intronic
938702967 2:133895352-133895374 CCTTCCCTAGGGGAAGAGGAAGG + Intergenic
943128630 2:183828265-183828287 CAGTCCCGAGTGGGAGAGGATGG - Intergenic
943568626 2:189545665-189545687 CAGTCCCAAGGGATAGAGCAGGG - Intergenic
945035355 2:205699668-205699690 CTCTGACAAGGGGAAGAAGAAGG + Intronic
946492307 2:220160982-220161004 CTGGCCCAAGAGGAAGATGAAGG - Intergenic
946632672 2:221687679-221687701 CTGTCTCTGGGGGATGAGGAAGG + Intergenic
947124926 2:226858666-226858688 GTGTCTCAAGGGGGAGAGAAAGG - Intronic
947684993 2:232075751-232075773 CTGAAGCAAGGGGAAGGGGAAGG - Intronic
947961133 2:234238409-234238431 CTCTCACAAGGGCAAGAAGAGGG + Intergenic
948056026 2:235009907-235009929 CTTTCCCAGGAGCAAGAGGAAGG - Intronic
948261555 2:236607760-236607782 GTGTCCCTAGAGGAAGAGGAAGG - Intergenic
948681327 2:239636911-239636933 CTGTACCAATGGGAAGATGAAGG - Intergenic
1169737459 20:8852448-8852470 CTGTCCCAAGAAGTGGAGGAAGG + Intronic
1170370341 20:15640972-15640994 CTGGCCCAAGGAAATGAGGAAGG - Intronic
1170947229 20:20902068-20902090 CTGTCCCCATGGGAACATGAGGG + Intergenic
1171138785 20:22722988-22723010 CTGTCCCAAGGGGAAGGAAGAGG + Intergenic
1171345402 20:24462048-24462070 CTGCTCCAAAGGGGAGAGGAAGG - Intergenic
1171769914 20:29314411-29314433 CACTCCAAAGGGGAGGAGGAGGG + Intergenic
1172220954 20:33274749-33274771 CTGGCCGAAGGTGAAGAGCATGG + Intronic
1172804025 20:37598395-37598417 TTCTCCCAAGGGAAAAAGGACGG - Intergenic
1173470784 20:43321870-43321892 CTCTCCCAAGGGGAATGGGTGGG - Intergenic
1174267643 20:49343543-49343565 CTGGGCCAAGGGGCAGCGGAGGG + Intergenic
1174285713 20:49471499-49471521 CCGTCCTGAGTGGAAGAGGAAGG + Intronic
1174336658 20:49866716-49866738 AAGTCTCAAGGGGAAGAGGAAGG - Intronic
1175772152 20:61630589-61630611 CTTCCCCAAGAGGAGGAGGAAGG - Intronic
1175994499 20:62806005-62806027 GGGTCCAAAGGGGAAGGGGAGGG - Intronic
1177184718 21:17780555-17780577 TTGTTCCAAAGGAAAGAGGAAGG + Intergenic
1177212501 21:18087931-18087953 ATGGCAGAAGGGGAAGAGGAAGG + Intronic
1178336627 21:31749417-31749439 CTCTCCCAAGGGGGAGAGAAGGG + Intergenic
1178343814 21:31808100-31808122 CAGTCTCAAGGGGCAGAGGCTGG + Intergenic
1179711173 21:43264069-43264091 CCCTCCCCAGGGGAAGGGGAGGG - Intergenic
1179802819 21:43819490-43819512 CAGTCCCAGGGGAGAGAGGAGGG + Intergenic
1180719518 22:17896982-17897004 CTGTCTCCAGAGAAAGAGGAGGG + Intronic
1181266075 22:21631758-21631780 CTGAGCAAAGGGGAAAAGGAGGG + Intergenic
1181779977 22:25185452-25185474 TTCCCCAAAGGGGAAGAGGAGGG - Intronic
1181815481 22:25433599-25433621 CTGTCGGAAGGGGAAGGGGAAGG + Intergenic
1182072714 22:27475004-27475026 CTGGCCCCAGGTGAAGAGGAGGG - Intergenic
1182292615 22:29293054-29293076 CTGTCCCTAGGGGTGGAGGAGGG - Intronic
1183939990 22:41288619-41288641 ACCTCCCAAAGGGAAGAGGAAGG + Intergenic
1183951815 22:41356769-41356791 CTCGCCCATGGGGAAGCGGAAGG - Exonic
1184516385 22:44965297-44965319 CTGTGCAGAGGGGAAGAGGCTGG - Intronic
1184657387 22:45948596-45948618 CTGTGGCAAGAGGCAGAGGAGGG - Intronic
950258945 3:11529932-11529954 CTGTCTCCTGGGCAAGAGGATGG - Intronic
950637397 3:14324537-14324559 CTGGGCCAAGGAGAACAGGATGG + Intergenic
950726151 3:14918353-14918375 CTTTACCATGGGGAAGGGGAAGG + Intronic
950841239 3:15970188-15970210 CCTGCCCAAGGCGAAGAGGAAGG - Intergenic
952889625 3:38031325-38031347 CTGTGCCAGGGGCCAGAGGAGGG - Intergenic
953914652 3:46910425-46910447 CTCTCCCAAGATGAAGAGGCTGG + Intergenic
953939811 3:47083823-47083845 CCATCCCAAGATGAAGAGGAGGG - Exonic
954246415 3:49335718-49335740 CTGTCACAAGAGCAAGAGCAGGG + Intronic
954429661 3:50463787-50463809 CTGTCCCAGGGGGAGAACGAAGG + Intronic
955905483 3:63803441-63803463 GTGTCCCAAGGAGAATGGGAAGG + Intergenic
956427807 3:69154920-69154942 CTCTGACAAGGGGAAGAGGCGGG + Intergenic
957593464 3:82229528-82229550 CTGTGCTTAGGGGAAAAGGAAGG - Intergenic
959869101 3:111306275-111306297 CTCTACCAAGGAGGAGAGGAGGG + Intronic
960945336 3:122962469-122962491 CTGTCCCGTGAGAAAGAGGACGG + Intronic
961178921 3:124860728-124860750 GTGTTCCAGAGGGAAGAGGAAGG - Intronic
962176754 3:133163306-133163328 CTGTCCAGTGGGGAAGAGGCAGG + Intronic
962611315 3:137078896-137078918 CTGTAAGAAGGAGAAGAGGAAGG + Intergenic
962809159 3:138946891-138946913 CGCTCCCTAGGGGAAGGGGAAGG - Exonic
962894108 3:139698543-139698565 CTGTCACAGGGGGAAGATCAGGG + Intergenic
963107754 3:141660752-141660774 CTGTCCCGAGGGGATGTGGAGGG - Intergenic
963122698 3:141789538-141789560 CTGTCCCAGGAGCCAGAGGAAGG + Intronic
963522435 3:146372526-146372548 CCATCCCTAGGGGAAGAGGGAGG - Intergenic
964036542 3:152206096-152206118 CTGGGCCTGGGGGAAGAGGAGGG - Intergenic
965345238 3:167540471-167540493 CCATCCCTAGGGGAAGGGGAAGG + Intronic
965371580 3:167869148-167869170 CTGACCTACAGGGAAGAGGAGGG - Intergenic
966809922 3:183834562-183834584 TTGTCGCCAGGGGTAGAGGAGGG + Intronic
966928125 3:184658752-184658774 CTGCCCCAGTTGGAAGAGGAAGG + Intronic
968597200 4:1491658-1491680 CTTCCCCAGGTGGAAGAGGAGGG - Intergenic
968652247 4:1764883-1764905 CTGCCCCGAGGAGAGGAGGAGGG - Intergenic
968871554 4:3245253-3245275 CTCTCCGATGAGGAAGAGGAAGG - Intronic
969414573 4:7050212-7050234 CTGGCCCCAGGGGCAGAGCAAGG - Intronic
969458969 4:7317571-7317593 CAGGCCCATGGGGAAGAGGAAGG - Intronic
970479767 4:16461074-16461096 GTGCCCCAAAGGGAAGTGGAAGG + Intergenic
971133448 4:23839367-23839389 TTCTCACAATGGGAAGAGGAAGG + Intronic
971302213 4:25451035-25451057 CTGTCCCCAGGTGGGGAGGATGG - Intergenic
975081046 4:70280903-70280925 CTGTGCCTATGGAAAGAGGAAGG + Intergenic
975543888 4:75542024-75542046 ATGTCCCAGGGGGATGATGAAGG - Intronic
976226126 4:82797205-82797227 ATTTCCAGAGGGGAAGAGGAAGG - Intronic
976505597 4:85842774-85842796 CTGGCACTAGGGGAAGAGGAAGG + Intronic
979175155 4:117653219-117653241 TTCTTACAAGGGGAAGAGGAAGG - Intergenic
979612391 4:122703142-122703164 CTGTTTCCAGAGGAAGAGGAGGG + Intergenic
979799676 4:124893329-124893351 CAATCCCAAGAGGTAGAGGAGGG - Intergenic
981426459 4:144609055-144609077 CTGTCCAAATGTGAAGTGGATGG + Intergenic
982240698 4:153296580-153296602 CAGCCCCAAGGAGAGGAGGAGGG + Intronic
982846045 4:160253787-160253809 GTGACCCAAGGGAAAGAGGATGG - Intergenic
984204302 4:176767877-176767899 CTGATCCAAGTGGAAGACGATGG + Intronic
984620329 4:181944870-181944892 CTGTTTCAAGTGGAAGAGGAAGG - Intergenic
985530155 5:429411-429433 CTGTCCCAGGAGGAAGTGGCAGG - Intronic
985870349 5:2549400-2549422 CATTCCCAAGGGCAAGAAGAAGG - Intergenic
987033208 5:13994736-13994758 CAGAGCCAAGGGGAAGAGGCGGG - Intergenic
989108111 5:37882233-37882255 CTGGTCCAAGGAGAAGAAGAGGG + Intergenic
992096896 5:73371107-73371129 ATCTTCCAAGGGGAAGATGAGGG - Intergenic
992894716 5:81236006-81236028 CTGTGCCAGTGTGAAGAGGAAGG - Intronic
993144083 5:84071648-84071670 CTTTCCAGAAGGGAAGAGGATGG + Intronic
993620506 5:90162496-90162518 CTGTCCAAAGGGGAAGCTGTAGG + Intergenic
993959690 5:94281685-94281707 TTGTCACAACTGGAAGAGGAGGG - Intronic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
995385848 5:111588006-111588028 CTTTGCAAAGGGGAAGAGGCAGG + Intergenic
995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG + Intergenic
996616400 5:125446420-125446442 CTGTGCCAAGGGTAGGAGCAGGG + Intergenic
996731672 5:126723156-126723178 ATGTCCCCAGGGCAAGAGCAAGG - Intergenic
997739641 5:136242375-136242397 CTGGCCTAAGGGGAGGAGCATGG - Intronic
997739742 5:136243134-136243156 CTGTCCCAAGGGGAAGAGGAAGG - Intronic
998174519 5:139893705-139893727 TTGTCCCAGGAGGAAGAGAATGG - Intronic
999263879 5:150253992-150254014 CTGTTTCAAGGGGCATAGGAAGG - Intronic
999303876 5:150507676-150507698 CTGTCCTGAGAAGAAGAGGAAGG - Intronic
999805112 5:155073811-155073833 ATGTCCTAAGTGAAAGAGGAAGG + Intergenic
999871113 5:155752432-155752454 GGGTACCAAGGGAAAGAGGATGG - Intergenic
1001219597 5:169888848-169888870 CTATCCCAAGGGAAAGAGGAGGG - Intronic
1001220264 5:169894544-169894566 TTTTCACAAGGGGAAGAGAAGGG + Intronic
1001558681 5:172655082-172655104 CCTTCCCTAGGTGAAGAGGAAGG - Intronic
1001665290 5:173428257-173428279 ATGGCAGAAGGGGAAGAGGAAGG + Intergenic
1004327530 6:14689204-14689226 GTGTCACAGGAGGAAGAGGAAGG + Intergenic
1004584599 6:16987340-16987362 GTGTCCCTAAGGGAAGAGGAAGG - Intergenic
1004769976 6:18770568-18770590 ATGTTGCAAGAGGAAGAGGAGGG + Intergenic
1005498902 6:26412964-26412986 GTGTCCAGAGGGGAAGAGGAGGG - Intronic
1006305984 6:33219055-33219077 CTGTCAGAAGGGGAAGTGGCAGG - Intergenic
1007005132 6:38354676-38354698 ATTTCACAAGGGGAAAAGGAGGG - Intronic
1007175182 6:39891511-39891533 CTCTGCCAAGAGGAAGGGGATGG + Intronic
1008696620 6:54045759-54045781 ATGGCACAAGGTGAAGAGGAAGG - Intronic
1010940874 6:81916193-81916215 CCCTCCCCAGGGGAACAGGAAGG + Intergenic
1014677096 6:124379940-124379962 GTTTACCAAGGAGAAGAGGAGGG + Intronic
1017065218 6:150522665-150522687 TTGGCCTAAGAGGAAGAGGAAGG - Intergenic
1018137351 6:160790271-160790293 CTTCCCCTAGGGGAAGGGGAAGG + Intergenic
1018397193 6:163387523-163387545 ATGTCCCAACAGGAAGAGGAGGG + Intergenic
1018489786 6:164280041-164280063 CTGTCCCAAATGGGAGAGGTTGG - Intergenic
1019309484 7:353227-353249 CCGTACCAGGGGGCAGAGGAGGG - Intergenic
1019407948 7:893731-893753 CTGTCCCAGTGGGAAGCTGACGG + Exonic
1019603109 7:1895118-1895140 CTGGGCCCAGGTGAAGAGGATGG + Intronic
1019706108 7:2498025-2498047 CTGTCTCTCGGGGAAGAGGAGGG - Intergenic
1019990385 7:4686293-4686315 CTGTCCCAAGGTGAAGAGGGTGG - Intronic
1022201319 7:28120447-28120469 TTGTCCCTAGGGGTAGAGGAAGG + Intronic
1023741865 7:43288194-43288216 CTTTCTCAATGAGAAGAGGAGGG + Intronic
1023798849 7:43815468-43815490 CCCTCCCCAGGGGAAGGGGAAGG + Intergenic
1024285339 7:47752227-47752249 CTTTCCCATGGGGAAGCAGAAGG + Intronic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1025190731 7:56893642-56893664 CTGTCCCAAGGCCAGCAGGAGGG + Intergenic
1025681212 7:63683282-63683304 CTGTCCCAAGGCCAGCAGGAGGG - Intergenic
1025806651 7:64839344-64839366 CTGCCATAAAGGGAAGAGGATGG - Intergenic
1026444346 7:70471033-70471055 CTGTCCCAGGGGGAAGAGCCCGG - Intronic
1026982595 7:74535605-74535627 CTGTCCCAGGAGGAAGATGCGGG + Intronic
1029514828 7:101018131-101018153 GAGTCCCAGGGGGAAGGGGAAGG - Intronic
1029546245 7:101212017-101212039 ATGCCCCCAGGAGAAGAGGAGGG + Intronic
1030849887 7:114470822-114470844 CTCTCCCTCGGGGAAGGGGAAGG + Intronic
1031920002 7:127593550-127593572 GTGCCCAAAGGGGAATAGGAAGG + Intronic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034734176 7:153413338-153413360 CTGCCATAAGGGGAAGAGGATGG - Intergenic
1037909191 8:22733673-22733695 CTGTGCAAATGGGAAGAGGTGGG - Intronic
1039002445 8:32996185-32996207 CTGTGCCCTGGGGAAGAGGAAGG - Intergenic
1039432188 8:37533578-37533600 CAGCCCGAAGGGGAAAAGGATGG - Intergenic
1040006709 8:42627239-42627261 CTGTCCCTAGAGGAAAATGATGG - Intergenic
1041623095 8:59996335-59996357 CTCTCTCAAGGGGAAGAGGTTGG + Intergenic
1042200444 8:66275653-66275675 GTTTCCCTAGGGGAAGGGGAAGG - Intergenic
1042382942 8:68139634-68139656 CTCTCCCAGGTGGGAGAGGATGG + Intronic
1044380579 8:91528344-91528366 CTGTTCCCAGAGGAAGAGGAAGG - Intergenic
1047330325 8:123880987-123881009 CTTTCCCAAGGGGAAGGGTTTGG - Intronic
1047346114 8:124030577-124030599 CTAACTCAAGGAGAAGAGGAAGG - Intronic
1047842476 8:128767687-128767709 CCATCCCTAGGGGAAGGGGAAGG + Intergenic
1048012227 8:130467035-130467057 CTGACCCAGGGGAAAGAGGAGGG + Intergenic
1049325305 8:142018378-142018400 CTGTCCCAAGGGCCTGAGCATGG - Intergenic
1051444025 9:17121314-17121336 CTAAACAAAGGGGAAGAGGAAGG - Intergenic
1052353096 9:27476997-27477019 CTGACCCCAGGTGAAGAAGACGG - Intronic
1057202909 9:93152437-93152459 CTGTCCCCTGGGGCAGAGAATGG + Intergenic
1057423336 9:94929197-94929219 CTGACTCTAGTGGAAGAGGAGGG - Intronic
1058936225 9:109772005-109772027 CTGTCCCCACGGAAAGAAGAAGG - Intronic
1059398885 9:114056368-114056390 CATTCCCAGGGAGAAGAGGAAGG + Exonic
1059568611 9:115409618-115409640 GTGTCCCATGGGGAAGACGGTGG + Intergenic
1060570088 9:124630566-124630588 CTATCCTAGGGGGAAGAGCATGG + Intronic
1060701390 9:125752297-125752319 GTGTCCGCAGGGGAAGAGAAAGG + Intronic
1060825391 9:126684751-126684773 CTGTACCAAGGGAAAGACCACGG - Intronic
1060826027 9:126688587-126688609 CTCTCCCGAGGGGCTGAGGAAGG - Intronic
1060917000 9:127397615-127397637 CTGTCCCGAGGGGAAGGGTGGGG - Intronic
1060972712 9:127747992-127748014 CTTTCCCAAGGAGGAGAGGATGG + Intronic
1061212915 9:129203790-129203812 GTGTCCTTAGGGGAAGGGGAAGG + Intergenic
1061216575 9:129225201-129225223 GGGTCCCAAGGGGGAGAGGGAGG - Intergenic
1061288536 9:129637955-129637977 CTGCCTCAAGGAGAAGTGGAGGG + Exonic
1061408380 9:130405068-130405090 CTGCCCCAAGGGGCACAGCAGGG + Intronic
1061778847 9:132984237-132984259 CAGACCCTAGGGGGAGAGGAGGG - Intronic
1062401961 9:136376704-136376726 CTGTCCCATGGGGGAGTGGGAGG - Intronic
1186110077 X:6246399-6246421 CTGTCCAAGGGGGAAAAGGGTGG - Intergenic
1186575341 X:10759567-10759589 CTCTCCCTAGGGGACGGGGAGGG + Intronic
1187342809 X:18436432-18436454 CTGTCCTTGGGGGAAGAGGTGGG + Intronic
1187611807 X:20951547-20951569 CTGCCCCATGTGGAAGAGGGAGG - Intergenic
1192798726 X:74446129-74446151 TTGGTCCCAGGGGAAGAGGAGGG - Intronic
1195570407 X:106393578-106393600 TTGTCTCAGGTGGAAGAGGAAGG - Intergenic
1196825668 X:119738384-119738406 CTGGCCCATGGGGGAGAGGGAGG - Intergenic
1198249915 X:134870169-134870191 TTGCCCAAAGGGAAAGAGGATGG + Intergenic
1198742224 X:139853198-139853220 CCTCCCCTAGGGGAAGAGGAAGG + Intronic
1200116683 X:153772633-153772655 CTGTCCCAAGGGGGACAGAGTGG + Intronic
1200218138 X:154377911-154377933 CTGTCTCATGGAGAAGAGAAAGG - Intergenic
1200782751 Y:7231709-7231731 CTGGCAGAAGGCGAAGAGGAAGG + Intergenic
1201770043 Y:17610517-17610539 CTGCCATAAAGGGAAGAGGATGG + Intergenic
1201831511 Y:18295470-18295492 CTGCCATAAAGGGAAGAGGATGG - Intergenic