ID: 997741786

View in Genome Browser
Species Human (GRCh38)
Location 5:136261425-136261447
Sequence CATTGTAACGGGAGAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997741786_997741790 4 Left 997741786 5:136261425-136261447 CCACCTTTTCTCCCGTTACAATG 0: 1
1: 0
2: 1
3: 14
4: 161
Right 997741790 5:136261452-136261474 AAGTGTTCACACTCCTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997741786 Original CRISPR CATTGTAACGGGAGAAAAGG TGG (reversed) Intronic
901532138 1:9860231-9860253 CAATGTCACTGGAGAAAAAGGGG + Intronic
902860030 1:19238615-19238637 CATTTTACCGGGAGATTAGGAGG - Intronic
904585480 1:31577437-31577459 CCTTGGATCGGGGGAAAAGGGGG - Exonic
906936196 1:50215883-50215905 CATGGTAACAGGAGAGAAGGGGG - Intergenic
907405548 1:54251544-54251566 CATGGAAACAGGAGAGAAGGCGG + Intronic
912310354 1:108614593-108614615 CATTGTAACAGGAGACAAAAAGG - Intronic
914940413 1:152018030-152018052 TATTTTAACGTGAGAGAAGGTGG + Intergenic
915272807 1:154767143-154767165 CATTGTAAGGAGATAAAAAGAGG - Intronic
915731999 1:158060461-158060483 CATGGGAAAGGGAGCAAAGGAGG - Intronic
918480051 1:184968887-184968909 CAGAGTAACTGGACAAAAGGAGG - Intronic
921115106 1:212082579-212082601 CATAGTAATTGGAGAAAAGGTGG + Intronic
923250366 1:232174885-232174907 CATTAAAAGGAGAGAAAAGGAGG - Intergenic
923982020 1:239335766-239335788 CAATGTAACAGTAGAGAAGGAGG + Intergenic
924552037 1:245087956-245087978 CATTGGAACTAGAGAAAAGAAGG + Intronic
924659814 1:246006021-246006043 TATTGAAAGGGGAGAAAAGGCGG + Intronic
924838362 1:247678731-247678753 AATTGTAAAAAGAGAAAAGGTGG + Intergenic
1063347443 10:5325153-5325175 CATTGTGACAGCAGAGAAGGTGG + Intergenic
1066318613 10:34276449-34276471 CATTTTAATTAGAGAAAAGGTGG - Intronic
1067429094 10:46231182-46231204 CCTAGTGAAGGGAGAAAAGGGGG - Intergenic
1069367709 10:67711440-67711462 GATAGGAACTGGAGAAAAGGTGG + Intergenic
1069656574 10:70093922-70093944 CATTATCAGGGGAGGAAAGGAGG - Intronic
1071345869 10:84692025-84692047 CATTGTAACAAGAGAAAAGGAGG + Intergenic
1071874700 10:89832467-89832489 GATTGGAACAGGAGAAAAGAGGG - Intergenic
1073529170 10:104215853-104215875 CATTGTAAGGGGAGAGGAGGCGG - Intronic
1073856502 10:107681293-107681315 CAATAAAACGGGAGAAAAGAAGG + Intergenic
1075795580 10:125117205-125117227 CATTGTAACGGGGGCAGTGGGGG + Intronic
1078308587 11:10216016-10216038 CCTGGTAATGGGAGAAATGGAGG - Intronic
1078324960 11:10372333-10372355 AATCGTAACGGGAGATGAGGGGG - Intronic
1079415475 11:20231640-20231662 CATTGTCAGGGGTGAGAAGGAGG + Intergenic
1089229504 11:116959536-116959558 CAATGTAACTGGGGAAAAGCGGG + Intronic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091335857 11:134765147-134765169 CATTCAAAAGGGGGAAAAGGTGG - Intergenic
1095761882 12:45848438-45848460 CATTGTAGCTGAAGAAAATGGGG - Intronic
1096510547 12:52125557-52125579 CATTATAAAGGGAGAAACAGTGG - Intergenic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099994760 12:89766268-89766290 CTATGTAAAGGGAGAAAAAGAGG + Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1106697260 13:32189399-32189421 CATATTAAAGAGAGAAAAGGTGG + Intronic
1110684578 13:78357210-78357232 CATTCTAAAGAGAGAAAAGTAGG + Intergenic
1118765177 14:68904733-68904755 CATCCTAGAGGGAGAAAAGGAGG + Exonic
1119053021 14:71389227-71389249 AATTGTAACTGGAGAGAAGAGGG + Intronic
1119274964 14:73346843-73346865 TATTTTAACAGGAGCAAAGGTGG - Intronic
1125109520 15:36014613-36014635 TATTTTAAAGGGAGAAAGGGAGG - Intergenic
1125265149 15:37870437-37870459 CATAGTACAGGGAGAAAAAGAGG + Intergenic
1126001469 15:44214391-44214413 CTTTGAAACGAGAGATAAGGAGG + Intergenic
1133486128 16:6220413-6220435 GATTGAAACAAGAGAAAAGGAGG + Intronic
1133938275 16:10285986-10286008 CTTTGAACTGGGAGAAAAGGTGG - Intergenic
1136285523 16:29238315-29238337 GAGTGTAAGGGGAGGAAAGGAGG + Intergenic
1138266984 16:55666666-55666688 CACAGTAACATGAGAAAAGGAGG - Intronic
1138272804 16:55708219-55708241 CATTGTCACGGGATAAAATGAGG - Intergenic
1138786520 16:59852938-59852960 CATTGAGGAGGGAGAAAAGGAGG + Intergenic
1143448562 17:7022637-7022659 CTGTGTTAAGGGAGAAAAGGGGG - Intergenic
1151811796 17:76448002-76448024 CATTGCAGAGGGAGAAAATGAGG + Intronic
1153536871 18:6111010-6111032 CATTGCTAAGGAAGAAAAGGAGG - Intronic
1155832826 18:30539506-30539528 CATTCTAACCAGAGAAAATGGGG + Intergenic
1157752481 18:50192322-50192344 AATTGTAACGGGATGAAATGTGG + Intronic
1158614677 18:58975602-58975624 CATAGTCACTGGAGAAAAGGAGG + Intronic
1159562052 18:70006562-70006584 CATTCTAATGGGAAAAGAGGGGG - Intronic
1164051350 19:21587412-21587434 CATTGTAACAGGAGAATAAATGG + Intergenic
1164244829 19:23419787-23419809 AATAGAAAAGGGAGAAAAGGGGG + Intergenic
1164435372 19:28224128-28224150 CCTTGTAAGGGGAGAAAAGAGGG + Intergenic
1166443240 19:42834521-42834543 CATTTAAATTGGAGAAAAGGGGG - Intronic
1166462935 19:43005269-43005291 CATTGAAATCAGAGAAAAGGGGG - Intronic
1166469063 19:43061730-43061752 CATTGAAATCAGAGAAAAGGGGG - Intronic
1166480204 19:43165247-43165269 CATTGAAATCAGAGAAAAGGGGG - Intronic
1166770937 19:45281752-45281774 CATTGTAACTGGGGCACAGGAGG + Intronic
927650401 2:24909552-24909574 CATTGTACAGAGAGAAATGGTGG - Intronic
932295949 2:70623459-70623481 CATTGAACTGGGGGAAAAGGTGG - Intronic
932481574 2:72042549-72042571 TATTGACACAGGAGAAAAGGGGG + Intergenic
933887609 2:86734293-86734315 GATGGTAAAGGAAGAAAAGGAGG + Intronic
933922568 2:87062419-87062441 GATGGTAAAGGAAGAAAAGGAGG - Intergenic
934135898 2:88996273-88996295 CAATGTCAGGGGAGTAAAGGAGG - Intergenic
934234420 2:90217500-90217522 CAATGTCAGGGGAGTAAAGGAGG + Intergenic
935870228 2:107439996-107440018 CATGGAAAAGGGAGAAAAAGGGG - Intergenic
937881937 2:126874876-126874898 CATTTTAAAGTGAGAAAATGAGG + Intergenic
938722954 2:134082670-134082692 CATTGTATATGGATAAAAGGGGG - Intergenic
938984876 2:136565207-136565229 AATTCTAATGGGAGAAAAAGGGG + Intergenic
941107892 2:161380520-161380542 CAGTATATTGGGAGAAAAGGGGG - Intronic
942454419 2:176128549-176128571 CATTGAAACGGGAGCAGAGAGGG + Intergenic
944034129 2:195272602-195272624 CACTGTAACAGTAGAAAAAGAGG + Intergenic
944634604 2:201662812-201662834 CAATGAAATGGGAGAAAATGAGG + Intronic
944770360 2:202908217-202908239 CATTTTAACCACAGAAAAGGAGG + Intronic
946112635 2:217433585-217433607 CACTGGAAGGGGAGAAAAGGAGG - Intronic
946459521 2:219856684-219856706 CAGTGTAACTGGAGCATAGGGGG + Intergenic
946770457 2:223083717-223083739 CATTGTTCCTGGGGAAAAGGAGG + Intronic
947339169 2:229119369-229119391 CATTGTTACTGGAGAAATGAAGG - Intronic
948230257 2:236344086-236344108 CATTGAAAGGAGAGAAAAGAAGG + Intronic
948341300 2:237254396-237254418 CACTGTAACCAGAGAAAAGTTGG + Intergenic
1174631187 20:51959033-51959055 CATTGGAATGGAAAAAAAGGAGG - Intergenic
1178820547 21:35971242-35971264 CAATGTAACGGGAGAAATAAAGG + Intronic
1185085430 22:48738212-48738234 TATTGTCACTGGAGGAAAGGAGG + Intronic
950881896 3:16328944-16328966 CACTGCAAGGGGAGAAAAGAAGG + Intronic
951348593 3:21577153-21577175 CAAAGTATAGGGAGAAAAGGAGG - Intronic
952663363 3:35877208-35877230 CTTTGAACTGGGAGAAAAGGCGG + Intergenic
953189034 3:40666235-40666257 CATTGTGGCGGGAGGAAAGGTGG + Intergenic
953515610 3:43588397-43588419 CATTGAAATGGGAAAAAAGATGG + Intronic
958054596 3:88393032-88393054 CTTTGTATCAGGAGGAAAGGAGG + Intergenic
962523811 3:136220450-136220472 CTTTGAACTGGGAGAAAAGGCGG + Intergenic
962945497 3:140165523-140165545 CAGGGTGACGGGAGAACAGGAGG + Intronic
967604680 3:191431502-191431524 CATTGTAAAGGAAGAAAACCAGG + Intergenic
968940253 4:3633965-3633987 CACTGGTACGGGAGAAAATGGGG - Intergenic
969911750 4:10453986-10454008 CACTGTAACTGGGGAAGAGGTGG + Intronic
970164150 4:13218529-13218551 CATTTTAAAGGGAGAGTAGGCGG - Intergenic
970631060 4:17945513-17945535 ACTTGGAAAGGGAGAAAAGGAGG - Intronic
971729730 4:30361668-30361690 CATTGTAAATGGATAGAAGGAGG - Intergenic
972568824 4:40292576-40292598 CATCAGAAGGGGAGAAAAGGAGG + Intergenic
973716543 4:53682429-53682451 CAATGCATAGGGAGAAAAGGTGG - Intronic
975048591 4:69831651-69831673 CATCGTAAAGGGAGGAAATGTGG - Intronic
975488280 4:74959466-74959488 CATGGTGAGGGGAGGAAAGGTGG - Intronic
976558661 4:86477414-86477436 CTTTGAACTGGGAGAAAAGGTGG - Intronic
977225244 4:94386351-94386373 CTTTGAACTGGGAGAAAAGGTGG + Intergenic
977918722 4:102621128-102621150 CATTTTAACAGGAAAAAAGGAGG + Intergenic
978609692 4:110523743-110523765 CATGGAAGAGGGAGAAAAGGTGG + Intronic
982719931 4:158848949-158848971 AATTGTAATTGGACAAAAGGGGG + Intronic
983833588 4:172362158-172362180 CTTTGTAAAGGTATAAAAGGAGG - Intronic
985057297 4:186047083-186047105 CTTTGAACTGGGAGAAAAGGCGG + Intergenic
986041733 5:4000272-4000294 CATTGTAAAGGATGAAAATGAGG + Intergenic
986446541 5:7826026-7826048 CATTGAAACGGGGGCTAAGGAGG - Intronic
987080183 5:14419046-14419068 CATGGTAAAAGGAGAGAAGGAGG + Intronic
987623411 5:20366367-20366389 CATTGGAACAGGAAAAAAAGTGG - Intronic
989633709 5:43512581-43512603 CAATGTTAGGGGAGAAAAGTAGG - Intronic
993233469 5:85270146-85270168 GAGTGTATCAGGAGAAAAGGGGG - Intergenic
993792782 5:92227557-92227579 CATTGAAAGGGTAGAAAAGATGG - Intergenic
993799715 5:92317861-92317883 AATTTAAAAGGGAGAAAAGGGGG + Intergenic
997699387 5:135885880-135885902 CATTGTAAGTGCAGAAATGGAGG + Intronic
997741786 5:136261425-136261447 CATTGTAACGGGAGAAAAGGTGG - Intronic
998348332 5:141484399-141484421 CATTGTAACAGGAGACACAGCGG - Intronic
1000279208 5:159767724-159767746 CCTTATAAGGGGAGGAAAGGGGG - Intergenic
1004344875 6:14839869-14839891 CATTCTAAACGGAGAGAAGGAGG - Intergenic
1006552274 6:34834420-34834442 CATTGTGAAGGGAGAGAATGGGG + Intronic
1008125476 6:47663623-47663645 CAGTGTAAGGGGAGAGCAGGAGG + Intronic
1009671846 6:66764032-66764054 CTTTGTAAAGGAAGAAAAGAAGG + Intergenic
1009906541 6:69875921-69875943 CATTATAAAGAGAGGAAAGGAGG + Intronic
1010119547 6:72358766-72358788 CATTGTTACAGGAGAGAAAGAGG + Intronic
1010354861 6:74920890-74920912 CCTTGTAAGAGGAGAAAATGTGG - Intergenic
1014115251 6:117662604-117662626 CTTTGAAATGGGGGAAAAGGTGG + Intergenic
1014937363 6:127400084-127400106 AATGGTAACAGGAGAAAAGAAGG - Intergenic
1016354825 6:143207159-143207181 CATTGCAACTGGGGCAAAGGAGG - Intronic
1016418896 6:143863451-143863473 CATTTAAACTGGAGAAAAGAAGG + Exonic
1017676836 6:156822892-156822914 CTCTGTAAAGGGAGAACAGGAGG - Intronic
1020530846 7:9332924-9332946 CAAAGTAATGGAAGAAAAGGAGG + Intergenic
1022443417 7:30451717-30451739 CACTGGAACGGGAGGAAGGGAGG + Exonic
1022845934 7:34209737-34209759 CATTGTGAAGGAAGAAAATGGGG + Intergenic
1028214024 7:88109772-88109794 CATTGTCACCGAAGAACAGGTGG + Intronic
1030838969 7:114324145-114324167 CATTGTACTGGGAGAATAGGAGG - Intronic
1033478747 7:141716960-141716982 TATTGTAACAGCAAAAAAGGGGG + Intronic
1036719077 8:11155913-11155935 CATTGCATCAGGAGAGAAGGAGG - Intronic
1037480226 8:19298241-19298263 CATTGTGATGAGAGGAAAGGAGG + Intergenic
1038844729 8:31217846-31217868 CATTCTAAGGGGAGAAAAATAGG + Intergenic
1039616647 8:38959838-38959860 CATTGTAACAGGAGCATGGGAGG + Intronic
1039759417 8:40558434-40558456 CAGGGGAAAGGGAGAAAAGGGGG + Intronic
1041524691 8:58792183-58792205 AATTGGAATGGGAGAAATGGTGG - Intergenic
1045546686 8:103135601-103135623 GATTGTAATGCAAGAAAAGGGGG - Intronic
1048247790 8:132827631-132827653 AATTGTAACTTGAGAGAAGGAGG + Intronic
1052520405 9:29540751-29540773 CATTGTTTTGGGGGAAAAGGGGG - Intergenic
1055981569 9:82008013-82008035 CATTGAAACAGCAGAAAAGAAGG + Intergenic
1057717225 9:97504138-97504160 CATTGTATGAGGAGAAAACGAGG - Intronic
1058406941 9:104687485-104687507 CATTGTAAGTGGAGAAGATGAGG + Intergenic
1058597754 9:106633191-106633213 CATTGTAAGTGGAGAAAAGAAGG - Intergenic
1059477853 9:114562181-114562203 CATTGCAATGGGAGTACAGGTGG + Intergenic
1060370631 9:123067172-123067194 CAATGGTATGGGAGAAAAGGAGG - Intronic
1061863929 9:133482371-133482393 AACTGTAAGGGTAGAAAAGGTGG + Intergenic
1062142358 9:134966706-134966728 CTTTGTCATGGGAGAAATGGGGG - Intergenic
1186265100 X:7823955-7823977 CATTATAATGGGAGAAAATGGGG + Intergenic
1187304952 X:18086644-18086666 CATTGTACCTGGGGACAAGGAGG - Intergenic
1189184271 X:39038923-39038945 CAGTGGAATGGGAGAAAAAGTGG + Intergenic
1194066249 X:89266206-89266228 CAGTGAAAAGGAAGAAAAGGGGG + Intergenic
1194568309 X:95521494-95521516 CAGTAGAAAGGGAGAAAAGGAGG + Intergenic
1195887644 X:109657051-109657073 GATTGTAAAGGGAGAACAGGAGG - Intronic
1196227122 X:113179679-113179701 CTTTGAAATGGGGGAAAAGGCGG + Intergenic
1200720420 Y:6600325-6600347 CAGTGAAAAGGAAGAAAAGGGGG + Intergenic
1200825496 Y:7635122-7635144 CTTTGTAACTGCAGAAAAAGAGG + Intergenic
1200957440 Y:8965408-8965430 CTTTGTAACTGCAGAAAAAGAGG - Intergenic
1201622836 Y:15979604-15979626 CATTGTACTGGGACAAGAGGAGG + Intergenic
1202234561 Y:22695973-22695995 CTTTGTAACTGCAGAAAAAGAGG - Intergenic
1202308598 Y:23500195-23500217 CTTTGTAACTGCAGAAAAAGAGG + Intergenic
1202562203 Y:26170391-26170413 CTTTGTAACTGCAGAAAAAGAGG - Intergenic