ID: 997760044

View in Genome Browser
Species Human (GRCh38)
Location 5:136436922-136436944
Sequence AAGTGCCAAGGTAATTCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997760044_997760046 9 Left 997760044 5:136436922-136436944 CCTATTGAATTACCTTGGCACTT No data
Right 997760046 5:136436954-136436976 AAGTAATTTATCATATATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997760044 Original CRISPR AAGTGCCAAGGTAATTCAAT AGG (reversed) Intergenic
No off target data available for this crispr