ID: 997762660

View in Genome Browser
Species Human (GRCh38)
Location 5:136464359-136464381
Sequence GTGGCCAGACTGACTGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997762660_997762669 27 Left 997762660 5:136464359-136464381 CCCAACTCAGTCAGTCTGGCCAC No data
Right 997762669 5:136464409-136464431 GACTGGTGGCTCTAAAATGAGGG No data
997762660_997762666 10 Left 997762660 5:136464359-136464381 CCCAACTCAGTCAGTCTGGCCAC No data
Right 997762666 5:136464392-136464414 ACAGATGTGAAAGCAGAGACTGG No data
997762660_997762667 13 Left 997762660 5:136464359-136464381 CCCAACTCAGTCAGTCTGGCCAC No data
Right 997762667 5:136464395-136464417 GATGTGAAAGCAGAGACTGGTGG No data
997762660_997762668 26 Left 997762660 5:136464359-136464381 CCCAACTCAGTCAGTCTGGCCAC No data
Right 997762668 5:136464408-136464430 AGACTGGTGGCTCTAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997762660 Original CRISPR GTGGCCAGACTGACTGAGTT GGG (reversed) Intergenic
No off target data available for this crispr