ID: 997762707

View in Genome Browser
Species Human (GRCh38)
Location 5:136464719-136464741
Sequence CTGGGGAAACCATAGCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997762707_997762714 5 Left 997762707 5:136464719-136464741 CCCAAATGCTATGGTTTCCCCAG No data
Right 997762714 5:136464747-136464769 CCTTTCAGCTTAGCTAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997762707 Original CRISPR CTGGGGAAACCATAGCATTT GGG (reversed) Intergenic
No off target data available for this crispr