ID: 997763655

View in Genome Browser
Species Human (GRCh38)
Location 5:136476415-136476437
Sequence TTCCATAAGATAGAGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3557
Summary {0: 21, 1: 337, 2: 543, 3: 550, 4: 2106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997763655_997763659 -5 Left 997763655 5:136476415-136476437 CCCTCTTTCTCTATCTTATGGAA 0: 21
1: 337
2: 543
3: 550
4: 2106
Right 997763659 5:136476433-136476455 TGGAATAGTGCCAATGGGATTGG No data
997763655_997763658 -10 Left 997763655 5:136476415-136476437 CCCTCTTTCTCTATCTTATGGAA 0: 21
1: 337
2: 543
3: 550
4: 2106
Right 997763658 5:136476428-136476450 TCTTATGGAATAGTGCCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997763655 Original CRISPR TTCCATAAGATAGAGAAAGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr