ID: 997763659

View in Genome Browser
Species Human (GRCh38)
Location 5:136476433-136476455
Sequence TGGAATAGTGCCAATGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997763655_997763659 -5 Left 997763655 5:136476415-136476437 CCCTCTTTCTCTATCTTATGGAA 0: 21
1: 337
2: 543
3: 550
4: 2106
Right 997763659 5:136476433-136476455 TGGAATAGTGCCAATGGGATTGG No data
997763656_997763659 -6 Left 997763656 5:136476416-136476438 CCTCTTTCTCTATCTTATGGAAT 0: 10
1: 234
2: 403
3: 451
4: 1834
Right 997763659 5:136476433-136476455 TGGAATAGTGCCAATGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997763659 Original CRISPR TGGAATAGTGCCAATGGGAT TGG Intergenic
No off target data available for this crispr