ID: 997769314

View in Genome Browser
Species Human (GRCh38)
Location 5:136540090-136540112
Sequence GTACTAATTATTCAATCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997769314_997769318 28 Left 997769314 5:136540090-136540112 CCATCCGATTGAATAATTAGTAC No data
Right 997769318 5:136540141-136540163 CACTCAGATGTACCTACAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997769314 Original CRISPR GTACTAATTATTCAATCGGA TGG (reversed) Intergenic
No off target data available for this crispr