ID: 997769315

View in Genome Browser
Species Human (GRCh38)
Location 5:136540094-136540116
Sequence GTGAGTACTAATTATTCAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997769315_997769318 24 Left 997769315 5:136540094-136540116 CCGATTGAATAATTAGTACTCAC No data
Right 997769318 5:136540141-136540163 CACTCAGATGTACCTACAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997769315 Original CRISPR GTGAGTACTAATTATTCAAT CGG (reversed) Intergenic
No off target data available for this crispr