ID: 997769318

View in Genome Browser
Species Human (GRCh38)
Location 5:136540141-136540163
Sequence CACTCAGATGTACCTACAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997769314_997769318 28 Left 997769314 5:136540090-136540112 CCATCCGATTGAATAATTAGTAC No data
Right 997769318 5:136540141-136540163 CACTCAGATGTACCTACAATCGG No data
997769315_997769318 24 Left 997769315 5:136540094-136540116 CCGATTGAATAATTAGTACTCAC No data
Right 997769318 5:136540141-136540163 CACTCAGATGTACCTACAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997769318 Original CRISPR CACTCAGATGTACCTACAAT CGG Intergenic
No off target data available for this crispr