ID: 997771912

View in Genome Browser
Species Human (GRCh38)
Location 5:136562982-136563004
Sequence CAGAATAAAATACCTCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997771912_997771921 22 Left 997771912 5:136562982-136563004 CCCAGTTGAGGTATTTTATTCTG No data
Right 997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG No data
997771912_997771916 -3 Left 997771912 5:136562982-136563004 CCCAGTTGAGGTATTTTATTCTG No data
Right 997771916 5:136563002-136563024 CTGGCTGCCCTGTTTGTTATGGG No data
997771912_997771919 14 Left 997771912 5:136562982-136563004 CCCAGTTGAGGTATTTTATTCTG No data
Right 997771919 5:136563019-136563041 TATGGGTTCTGCTTGAAGATAGG No data
997771912_997771920 15 Left 997771912 5:136562982-136563004 CCCAGTTGAGGTATTTTATTCTG No data
Right 997771920 5:136563020-136563042 ATGGGTTCTGCTTGAAGATAGGG No data
997771912_997771915 -4 Left 997771912 5:136562982-136563004 CCCAGTTGAGGTATTTTATTCTG No data
Right 997771915 5:136563001-136563023 TCTGGCTGCCCTGTTTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997771912 Original CRISPR CAGAATAAAATACCTCAACT GGG (reversed) Intergenic
No off target data available for this crispr