ID: 997771918

View in Genome Browser
Species Human (GRCh38)
Location 5:136563010-136563032
Sequence AAGCAGAACCCATAACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997771918_997771923 28 Left 997771918 5:136563010-136563032 CCTGTTTGTTATGGGTTCTGCTT No data
Right 997771923 5:136563061-136563083 TATGACATTCCTTCAGTCTGTGG No data
997771918_997771922 3 Left 997771918 5:136563010-136563032 CCTGTTTGTTATGGGTTCTGCTT No data
Right 997771922 5:136563036-136563058 GATAGGGAAGATGGTAAGTGTGG No data
997771918_997771921 -6 Left 997771918 5:136563010-136563032 CCTGTTTGTTATGGGTTCTGCTT No data
Right 997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997771918 Original CRISPR AAGCAGAACCCATAACAAAC AGG (reversed) Intergenic
No off target data available for this crispr