ID: 997771921

View in Genome Browser
Species Human (GRCh38)
Location 5:136563027-136563049
Sequence CTGCTTGAAGATAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997771918_997771921 -6 Left 997771918 5:136563010-136563032 CCTGTTTGTTATGGGTTCTGCTT No data
Right 997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG No data
997771917_997771921 -5 Left 997771917 5:136563009-136563031 CCCTGTTTGTTATGGGTTCTGCT No data
Right 997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG No data
997771913_997771921 21 Left 997771913 5:136562983-136563005 CCAGTTGAGGTATTTTATTCTGG No data
Right 997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG No data
997771912_997771921 22 Left 997771912 5:136562982-136563004 CCCAGTTGAGGTATTTTATTCTG No data
Right 997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG No data
997771911_997771921 25 Left 997771911 5:136562979-136563001 CCACCCAGTTGAGGTATTTTATT No data
Right 997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997771921 Original CRISPR CTGCTTGAAGATAGGGAAGA TGG Intergenic
No off target data available for this crispr