ID: 997773308

View in Genome Browser
Species Human (GRCh38)
Location 5:136574508-136574530
Sequence GACTATGCTTCAACTAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997773305_997773308 -5 Left 997773305 5:136574490-136574512 CCATCAACCCTCTGAAAAGACTA No data
Right 997773308 5:136574508-136574530 GACTATGCTTCAACTAGAGTTGG No data
997773304_997773308 -4 Left 997773304 5:136574489-136574511 CCCATCAACCCTCTGAAAAGACT No data
Right 997773308 5:136574508-136574530 GACTATGCTTCAACTAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997773308 Original CRISPR GACTATGCTTCAACTAGAGT TGG Intergenic
No off target data available for this crispr