ID: 997773385

View in Genome Browser
Species Human (GRCh38)
Location 5:136575226-136575248
Sequence GGACAATGGCGTAGTGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997773371_997773385 30 Left 997773371 5:136575173-136575195 CCACAATATCAAATGCATTGGCA No data
Right 997773385 5:136575226-136575248 GGACAATGGCGTAGTGGTGCAGG No data
997773378_997773385 1 Left 997773378 5:136575202-136575224 CCCGGGAGGGAATCTTGGTGCCT No data
Right 997773385 5:136575226-136575248 GGACAATGGCGTAGTGGTGCAGG No data
997773379_997773385 0 Left 997773379 5:136575203-136575225 CCGGGAGGGAATCTTGGTGCCTG No data
Right 997773385 5:136575226-136575248 GGACAATGGCGTAGTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997773385 Original CRISPR GGACAATGGCGTAGTGGTGC AGG Intergenic
No off target data available for this crispr