ID: 997779906

View in Genome Browser
Species Human (GRCh38)
Location 5:136646223-136646245
Sequence CTCCCCTCCATTAAAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997779899_997779906 14 Left 997779899 5:136646186-136646208 CCCTAGGCAAACTCCATTCATTT No data
Right 997779906 5:136646223-136646245 CTCCCCTCCATTAAAGGAGGTGG No data
997779900_997779906 13 Left 997779900 5:136646187-136646209 CCTAGGCAAACTCCATTCATTTT No data
Right 997779906 5:136646223-136646245 CTCCCCTCCATTAAAGGAGGTGG No data
997779901_997779906 1 Left 997779901 5:136646199-136646221 CCATTCATTTTCTGAATCCCAGT No data
Right 997779906 5:136646223-136646245 CTCCCCTCCATTAAAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997779906 Original CRISPR CTCCCCTCCATTAAAGGAGG TGG Intergenic
No off target data available for this crispr