ID: 997780041

View in Genome Browser
Species Human (GRCh38)
Location 5:136647913-136647935
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997780041_997780046 12 Left 997780041 5:136647913-136647935 CCTTTCTCTCTATTCTTTAAATA No data
Right 997780046 5:136647948-136647970 TGGCCTACCCTCAGGAGGCAGGG No data
997780041_997780042 -8 Left 997780041 5:136647913-136647935 CCTTTCTCTCTATTCTTTAAATA No data
Right 997780042 5:136647928-136647950 TTTAAATATGTCACTAAGTTTGG No data
997780041_997780045 11 Left 997780041 5:136647913-136647935 CCTTTCTCTCTATTCTTTAAATA No data
Right 997780045 5:136647947-136647969 TTGGCCTACCCTCAGGAGGCAGG No data
997780041_997780044 7 Left 997780041 5:136647913-136647935 CCTTTCTCTCTATTCTTTAAATA No data
Right 997780044 5:136647943-136647965 AAGTTTGGCCTACCCTCAGGAGG No data
997780041_997780043 4 Left 997780041 5:136647913-136647935 CCTTTCTCTCTATTCTTTAAATA No data
Right 997780043 5:136647940-136647962 ACTAAGTTTGGCCTACCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997780041 Original CRISPR TATTTAAAGAATAGAGAGAA AGG (reversed) Intergenic