ID: 997780042 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:136647928-136647950 |
Sequence | TTTAAATATGTCACTAAGTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997780041_997780042 | -8 | Left | 997780041 | 5:136647913-136647935 | CCTTTCTCTCTATTCTTTAAATA | No data | ||
Right | 997780042 | 5:136647928-136647950 | TTTAAATATGTCACTAAGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997780042 | Original CRISPR | TTTAAATATGTCACTAAGTT TGG | Intergenic | ||