ID: 997780043

View in Genome Browser
Species Human (GRCh38)
Location 5:136647940-136647962
Sequence ACTAAGTTTGGCCTACCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997780041_997780043 4 Left 997780041 5:136647913-136647935 CCTTTCTCTCTATTCTTTAAATA No data
Right 997780043 5:136647940-136647962 ACTAAGTTTGGCCTACCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997780043 Original CRISPR ACTAAGTTTGGCCTACCCTC AGG Intergenic
No off target data available for this crispr