ID: 997781687

View in Genome Browser
Species Human (GRCh38)
Location 5:136666101-136666123
Sequence TTAGGAAGAAGTAGAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997781684_997781687 -9 Left 997781684 5:136666087-136666109 CCAACAATAGTTCCTTAGGAAGA No data
Right 997781687 5:136666101-136666123 TTAGGAAGAAGTAGAATTGTGGG No data
997781682_997781687 17 Left 997781682 5:136666061-136666083 CCTTCTAGCGACATCTATGAGTC No data
Right 997781687 5:136666101-136666123 TTAGGAAGAAGTAGAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997781687 Original CRISPR TTAGGAAGAAGTAGAATTGT GGG Intergenic
No off target data available for this crispr