ID: 997782007

View in Genome Browser
Species Human (GRCh38)
Location 5:136668082-136668104
Sequence GTCCAGGCAGACTGATTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997782007_997782014 13 Left 997782007 5:136668082-136668104 CCCAAGAATCAGTCTGCCTGGAC No data
Right 997782014 5:136668118-136668140 TGCCAGCGTATGCCACCCTGGGG No data
997782007_997782012 11 Left 997782007 5:136668082-136668104 CCCAAGAATCAGTCTGCCTGGAC No data
Right 997782012 5:136668116-136668138 AGTGCCAGCGTATGCCACCCTGG No data
997782007_997782013 12 Left 997782007 5:136668082-136668104 CCCAAGAATCAGTCTGCCTGGAC No data
Right 997782013 5:136668117-136668139 GTGCCAGCGTATGCCACCCTGGG No data
997782007_997782016 20 Left 997782007 5:136668082-136668104 CCCAAGAATCAGTCTGCCTGGAC No data
Right 997782016 5:136668125-136668147 GTATGCCACCCTGGGGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997782007 Original CRISPR GTCCAGGCAGACTGATTCTT GGG (reversed) Intergenic
No off target data available for this crispr