ID: 997782008

View in Genome Browser
Species Human (GRCh38)
Location 5:136668083-136668105
Sequence GGTCCAGGCAGACTGATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997782008_997782012 10 Left 997782008 5:136668083-136668105 CCAAGAATCAGTCTGCCTGGACC No data
Right 997782012 5:136668116-136668138 AGTGCCAGCGTATGCCACCCTGG No data
997782008_997782014 12 Left 997782008 5:136668083-136668105 CCAAGAATCAGTCTGCCTGGACC No data
Right 997782014 5:136668118-136668140 TGCCAGCGTATGCCACCCTGGGG No data
997782008_997782016 19 Left 997782008 5:136668083-136668105 CCAAGAATCAGTCTGCCTGGACC No data
Right 997782016 5:136668125-136668147 GTATGCCACCCTGGGGTCCAAGG No data
997782008_997782013 11 Left 997782008 5:136668083-136668105 CCAAGAATCAGTCTGCCTGGACC No data
Right 997782013 5:136668117-136668139 GTGCCAGCGTATGCCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997782008 Original CRISPR GGTCCAGGCAGACTGATTCT TGG (reversed) Intergenic
No off target data available for this crispr