ID: 997782009

View in Genome Browser
Species Human (GRCh38)
Location 5:136668098-136668120
Sequence GCACTGGTGTTAGCAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997782009_997782012 -5 Left 997782009 5:136668098-136668120 CCTGGACCTGCTAACACCAGTGC No data
Right 997782012 5:136668116-136668138 AGTGCCAGCGTATGCCACCCTGG No data
997782009_997782013 -4 Left 997782009 5:136668098-136668120 CCTGGACCTGCTAACACCAGTGC No data
Right 997782013 5:136668117-136668139 GTGCCAGCGTATGCCACCCTGGG No data
997782009_997782016 4 Left 997782009 5:136668098-136668120 CCTGGACCTGCTAACACCAGTGC No data
Right 997782016 5:136668125-136668147 GTATGCCACCCTGGGGTCCAAGG No data
997782009_997782014 -3 Left 997782009 5:136668098-136668120 CCTGGACCTGCTAACACCAGTGC No data
Right 997782014 5:136668118-136668140 TGCCAGCGTATGCCACCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997782009 Original CRISPR GCACTGGTGTTAGCAGGTCC AGG (reversed) Intergenic