ID: 997782010

View in Genome Browser
Species Human (GRCh38)
Location 5:136668104-136668126
Sequence ACGCTGGCACTGGTGTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997782010_997782013 -10 Left 997782010 5:136668104-136668126 CCTGCTAACACCAGTGCCAGCGT No data
Right 997782013 5:136668117-136668139 GTGCCAGCGTATGCCACCCTGGG No data
997782010_997782014 -9 Left 997782010 5:136668104-136668126 CCTGCTAACACCAGTGCCAGCGT No data
Right 997782014 5:136668118-136668140 TGCCAGCGTATGCCACCCTGGGG No data
997782010_997782016 -2 Left 997782010 5:136668104-136668126 CCTGCTAACACCAGTGCCAGCGT No data
Right 997782016 5:136668125-136668147 GTATGCCACCCTGGGGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997782010 Original CRISPR ACGCTGGCACTGGTGTTAGC AGG (reversed) Intergenic
No off target data available for this crispr