ID: 997782010 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:136668104-136668126 |
Sequence | ACGCTGGCACTGGTGTTAGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997782010_997782016 | -2 | Left | 997782010 | 5:136668104-136668126 | CCTGCTAACACCAGTGCCAGCGT | No data | ||
Right | 997782016 | 5:136668125-136668147 | GTATGCCACCCTGGGGTCCAAGG | No data | ||||
997782010_997782013 | -10 | Left | 997782010 | 5:136668104-136668126 | CCTGCTAACACCAGTGCCAGCGT | No data | ||
Right | 997782013 | 5:136668117-136668139 | GTGCCAGCGTATGCCACCCTGGG | No data | ||||
997782010_997782014 | -9 | Left | 997782010 | 5:136668104-136668126 | CCTGCTAACACCAGTGCCAGCGT | No data | ||
Right | 997782014 | 5:136668118-136668140 | TGCCAGCGTATGCCACCCTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997782010 | Original CRISPR | ACGCTGGCACTGGTGTTAGC AGG (reversed) | Intergenic | ||