ID: 997782013

View in Genome Browser
Species Human (GRCh38)
Location 5:136668117-136668139
Sequence GTGCCAGCGTATGCCACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997782005_997782013 23 Left 997782005 5:136668071-136668093 CCACATGGAGACCCAAGAATCAG No data
Right 997782013 5:136668117-136668139 GTGCCAGCGTATGCCACCCTGGG No data
997782009_997782013 -4 Left 997782009 5:136668098-136668120 CCTGGACCTGCTAACACCAGTGC No data
Right 997782013 5:136668117-136668139 GTGCCAGCGTATGCCACCCTGGG No data
997782008_997782013 11 Left 997782008 5:136668083-136668105 CCAAGAATCAGTCTGCCTGGACC No data
Right 997782013 5:136668117-136668139 GTGCCAGCGTATGCCACCCTGGG No data
997782007_997782013 12 Left 997782007 5:136668082-136668104 CCCAAGAATCAGTCTGCCTGGAC No data
Right 997782013 5:136668117-136668139 GTGCCAGCGTATGCCACCCTGGG No data
997782010_997782013 -10 Left 997782010 5:136668104-136668126 CCTGCTAACACCAGTGCCAGCGT No data
Right 997782013 5:136668117-136668139 GTGCCAGCGTATGCCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997782013 Original CRISPR GTGCCAGCGTATGCCACCCT GGG Intergenic
No off target data available for this crispr