ID: 997786759

View in Genome Browser
Species Human (GRCh38)
Location 5:136720637-136720659
Sequence AGTTACACAAAGTGTCAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997786759_997786762 -8 Left 997786759 5:136720637-136720659 CCCAACTGACACTTTGTGTAACT No data
Right 997786762 5:136720652-136720674 GTGTAACTGAGCAAAGGACTCGG No data
997786759_997786764 21 Left 997786759 5:136720637-136720659 CCCAACTGACACTTTGTGTAACT No data
Right 997786764 5:136720681-136720703 TGTGCTGGATTTCTGACCTATGG No data
997786759_997786765 29 Left 997786759 5:136720637-136720659 CCCAACTGACACTTTGTGTAACT No data
Right 997786765 5:136720689-136720711 ATTTCTGACCTATGGAAACTAGG No data
997786759_997786763 6 Left 997786759 5:136720637-136720659 CCCAACTGACACTTTGTGTAACT No data
Right 997786763 5:136720666-136720688 AGGACTCGGCTCAGCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997786759 Original CRISPR AGTTACACAAAGTGTCAGTT GGG (reversed) Intergenic
No off target data available for this crispr