ID: 997792680

View in Genome Browser
Species Human (GRCh38)
Location 5:136775560-136775582
Sequence AAATCTAGGCCTCTTCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997792680_997792684 20 Left 997792680 5:136775560-136775582 CCCATGAGAAGAGGCCTAGATTT No data
Right 997792684 5:136775603-136775625 CCTGCTCTCTGCTCTTCCAATGG No data
997792680_997792685 21 Left 997792680 5:136775560-136775582 CCCATGAGAAGAGGCCTAGATTT No data
Right 997792685 5:136775604-136775626 CTGCTCTCTGCTCTTCCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997792680 Original CRISPR AAATCTAGGCCTCTTCTCAT GGG (reversed) Intergenic