ID: 997792763

View in Genome Browser
Species Human (GRCh38)
Location 5:136776689-136776711
Sequence CTCTGCTGGGCCTCTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997792758_997792763 21 Left 997792758 5:136776645-136776667 CCTCTTGTGTGCTTGTAGCTGTC No data
Right 997792763 5:136776689-136776711 CTCTGCTGGGCCTCTTTTGTTGG No data
997792759_997792763 -4 Left 997792759 5:136776670-136776692 CCTTTCTTCTCAGTTGTTCCTCT No data
Right 997792763 5:136776689-136776711 CTCTGCTGGGCCTCTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997792763 Original CRISPR CTCTGCTGGGCCTCTTTTGT TGG Intergenic
No off target data available for this crispr