ID: 997797074

View in Genome Browser
Species Human (GRCh38)
Location 5:136820971-136820993
Sequence GTAGCTCAGAAGTTCTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997797070_997797074 8 Left 997797070 5:136820940-136820962 CCCTGGAGGTGCACAGCACTGGG No data
Right 997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG No data
997797067_997797074 10 Left 997797067 5:136820938-136820960 CCCCCTGGAGGTGCACAGCACTG No data
Right 997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG No data
997797066_997797074 13 Left 997797066 5:136820935-136820957 CCACCCCCTGGAGGTGCACAGCA No data
Right 997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG No data
997797065_997797074 18 Left 997797065 5:136820930-136820952 CCAAGCCACCCCCTGGAGGTGCA No data
Right 997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG No data
997797061_997797074 27 Left 997797061 5:136820921-136820943 CCAGCCAAGCCAAGCCACCCCCT No data
Right 997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG No data
997797063_997797074 23 Left 997797063 5:136820925-136820947 CCAAGCCAAGCCACCCCCTGGAG No data
Right 997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG No data
997797068_997797074 9 Left 997797068 5:136820939-136820961 CCCCTGGAGGTGCACAGCACTGG No data
Right 997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG No data
997797072_997797074 7 Left 997797072 5:136820941-136820963 CCTGGAGGTGCACAGCACTGGGG No data
Right 997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997797074 Original CRISPR GTAGCTCAGAAGTTCTATGT TGG Intergenic
No off target data available for this crispr