ID: 997801293

View in Genome Browser
Species Human (GRCh38)
Location 5:136865273-136865295
Sequence AGATGTAAGCTGCAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997801293_997801299 15 Left 997801293 5:136865273-136865295 CCCTCCTGCTGCAGCTTACATCT No data
Right 997801299 5:136865311-136865333 AAATGCCCTGCCTATCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997801293 Original CRISPR AGATGTAAGCTGCAGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr