ID: 997803539

View in Genome Browser
Species Human (GRCh38)
Location 5:136890628-136890650
Sequence AAAGTGGCTAACATTTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997803539_997803546 11 Left 997803539 5:136890628-136890650 CCCAAACAAATGTTAGCCACTTT No data
Right 997803546 5:136890662-136890684 GCCAGGCACCATGCTAGGGGTGG No data
997803539_997803545 8 Left 997803539 5:136890628-136890650 CCCAAACAAATGTTAGCCACTTT No data
Right 997803545 5:136890659-136890681 TGAGCCAGGCACCATGCTAGGGG No data
997803539_997803542 -6 Left 997803539 5:136890628-136890650 CCCAAACAAATGTTAGCCACTTT No data
Right 997803542 5:136890645-136890667 CACTTTTATGACTATGAGCCAGG No data
997803539_997803544 7 Left 997803539 5:136890628-136890650 CCCAAACAAATGTTAGCCACTTT No data
Right 997803544 5:136890658-136890680 ATGAGCCAGGCACCATGCTAGGG No data
997803539_997803548 12 Left 997803539 5:136890628-136890650 CCCAAACAAATGTTAGCCACTTT No data
Right 997803548 5:136890663-136890685 CCAGGCACCATGCTAGGGGTGGG No data
997803539_997803543 6 Left 997803539 5:136890628-136890650 CCCAAACAAATGTTAGCCACTTT No data
Right 997803543 5:136890657-136890679 TATGAGCCAGGCACCATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997803539 Original CRISPR AAAGTGGCTAACATTTGTTT GGG (reversed) Intergenic
No off target data available for this crispr