ID: 997803540

View in Genome Browser
Species Human (GRCh38)
Location 5:136890629-136890651
Sequence AAAAGTGGCTAACATTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997803540_997803548 11 Left 997803540 5:136890629-136890651 CCAAACAAATGTTAGCCACTTTT No data
Right 997803548 5:136890663-136890685 CCAGGCACCATGCTAGGGGTGGG No data
997803540_997803543 5 Left 997803540 5:136890629-136890651 CCAAACAAATGTTAGCCACTTTT No data
Right 997803543 5:136890657-136890679 TATGAGCCAGGCACCATGCTAGG No data
997803540_997803544 6 Left 997803540 5:136890629-136890651 CCAAACAAATGTTAGCCACTTTT No data
Right 997803544 5:136890658-136890680 ATGAGCCAGGCACCATGCTAGGG No data
997803540_997803546 10 Left 997803540 5:136890629-136890651 CCAAACAAATGTTAGCCACTTTT No data
Right 997803546 5:136890662-136890684 GCCAGGCACCATGCTAGGGGTGG No data
997803540_997803542 -7 Left 997803540 5:136890629-136890651 CCAAACAAATGTTAGCCACTTTT No data
Right 997803542 5:136890645-136890667 CACTTTTATGACTATGAGCCAGG No data
997803540_997803545 7 Left 997803540 5:136890629-136890651 CCAAACAAATGTTAGCCACTTTT No data
Right 997803545 5:136890659-136890681 TGAGCCAGGCACCATGCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997803540 Original CRISPR AAAAGTGGCTAACATTTGTT TGG (reversed) Intergenic
No off target data available for this crispr