ID: 997803542

View in Genome Browser
Species Human (GRCh38)
Location 5:136890645-136890667
Sequence CACTTTTATGACTATGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997803539_997803542 -6 Left 997803539 5:136890628-136890650 CCCAAACAAATGTTAGCCACTTT No data
Right 997803542 5:136890645-136890667 CACTTTTATGACTATGAGCCAGG No data
997803540_997803542 -7 Left 997803540 5:136890629-136890651 CCAAACAAATGTTAGCCACTTTT No data
Right 997803542 5:136890645-136890667 CACTTTTATGACTATGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997803542 Original CRISPR CACTTTTATGACTATGAGCC AGG Intergenic
No off target data available for this crispr