ID: 997804784

View in Genome Browser
Species Human (GRCh38)
Location 5:136906289-136906311
Sequence TTGGTGACAAGGGTCTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804784_997804794 27 Left 997804784 5:136906289-136906311 CCCTTCCAGACCCTTGTCACCAA No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804784_997804792 5 Left 997804784 5:136906289-136906311 CCCTTCCAGACCCTTGTCACCAA No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804784 Original CRISPR TTGGTGACAAGGGTCTGGAA GGG (reversed) Intergenic
No off target data available for this crispr