ID: 997804786

View in Genome Browser
Species Human (GRCh38)
Location 5:136906294-136906316
Sequence GAACATTGGTGACAAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804786_997804792 0 Left 997804786 5:136906294-136906316 CCAGACCCTTGTCACCAATGTTC No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
997804786_997804794 22 Left 997804786 5:136906294-136906316 CCAGACCCTTGTCACCAATGTTC No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804786 Original CRISPR GAACATTGGTGACAAGGGTC TGG (reversed) Intergenic
No off target data available for this crispr