ID: 997804788

View in Genome Browser
Species Human (GRCh38)
Location 5:136906300-136906322
Sequence ACTGGGGAACATTGGTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804788_997804795 29 Left 997804788 5:136906300-136906322 CCTTGTCACCAATGTTCCCCAGT No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data
997804788_997804794 16 Left 997804788 5:136906300-136906322 CCTTGTCACCAATGTTCCCCAGT No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804788_997804792 -6 Left 997804788 5:136906300-136906322 CCTTGTCACCAATGTTCCCCAGT No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804788 Original CRISPR ACTGGGGAACATTGGTGACA AGG (reversed) Intergenic
No off target data available for this crispr