ID: 997804789

View in Genome Browser
Species Human (GRCh38)
Location 5:136906308-136906330
Sequence CTGTTCTTACTGGGGAACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804789_997804795 21 Left 997804789 5:136906308-136906330 CCAATGTTCCCCAGTAAGAACAG No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data
997804789_997804794 8 Left 997804789 5:136906308-136906330 CCAATGTTCCCCAGTAAGAACAG No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804789_997804796 25 Left 997804789 5:136906308-136906330 CCAATGTTCCCCAGTAAGAACAG No data
Right 997804796 5:136906356-136906378 CATAGGAGAATTAATCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804789 Original CRISPR CTGTTCTTACTGGGGAACAT TGG (reversed) Intergenic
No off target data available for this crispr