ID: 997804790

View in Genome Browser
Species Human (GRCh38)
Location 5:136906316-136906338
Sequence CATATATACTGTTCTTACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804790_997804796 17 Left 997804790 5:136906316-136906338 CCCCAGTAAGAACAGTATATATG No data
Right 997804796 5:136906356-136906378 CATAGGAGAATTAATCAGGAAGG No data
997804790_997804794 0 Left 997804790 5:136906316-136906338 CCCCAGTAAGAACAGTATATATG No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data
997804790_997804795 13 Left 997804790 5:136906316-136906338 CCCCAGTAAGAACAGTATATATG No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804790 Original CRISPR CATATATACTGTTCTTACTG GGG (reversed) Intergenic
No off target data available for this crispr