ID: 997804791

View in Genome Browser
Species Human (GRCh38)
Location 5:136906317-136906339
Sequence CCATATATACTGTTCTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804791_997804795 12 Left 997804791 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
Right 997804795 5:136906352-136906374 CAGACATAGGAGAATTAATCAGG No data
997804791_997804796 16 Left 997804791 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
Right 997804796 5:136906356-136906378 CATAGGAGAATTAATCAGGAAGG No data
997804791_997804794 -1 Left 997804791 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
Right 997804794 5:136906339-136906361 GTCTTATAGAAATCAGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804791 Original CRISPR CCATATATACTGTTCTTACT GGG (reversed) Intergenic
No off target data available for this crispr