ID: 997804792

View in Genome Browser
Species Human (GRCh38)
Location 5:136906317-136906339
Sequence CCCAGTAAGAACAGTATATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997804782_997804792 19 Left 997804782 5:136906275-136906297 CCCATAAGGGGGAACCCTTCCAG No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
997804787_997804792 -5 Left 997804787 5:136906299-136906321 CCCTTGTCACCAATGTTCCCCAG No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
997804781_997804792 24 Left 997804781 5:136906270-136906292 CCTGTCCCATAAGGGGGAACCCT No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
997804784_997804792 5 Left 997804784 5:136906289-136906311 CCCTTCCAGACCCTTGTCACCAA No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
997804783_997804792 18 Left 997804783 5:136906276-136906298 CCATAAGGGGGAACCCTTCCAGA No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
997804780_997804792 27 Left 997804780 5:136906267-136906289 CCTCCTGTCCCATAAGGGGGAAC No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
997804788_997804792 -6 Left 997804788 5:136906300-136906322 CCTTGTCACCAATGTTCCCCAGT No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
997804786_997804792 0 Left 997804786 5:136906294-136906316 CCAGACCCTTGTCACCAATGTTC No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data
997804785_997804792 4 Left 997804785 5:136906290-136906312 CCTTCCAGACCCTTGTCACCAAT No data
Right 997804792 5:136906317-136906339 CCCAGTAAGAACAGTATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997804792 Original CRISPR CCCAGTAAGAACAGTATATA TGG Intergenic
No off target data available for this crispr